Mutagenetix > Incidental Mutations

Incidental Mutation 'R1437:Plch1'

161276

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

MMRRC Submission

039492-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R1437 (G1)

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 63697533 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1641 (R1641L)

Ref Sequence

ENSEMBL: ENSMUSP00000135424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

Predicted Effect

probably benign
Transcript: ENSMUST00000048134
AA Change: R1611L

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: R1611L

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059973
AA Change: R1649L

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: R1649L

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084105
AA Change: R1650L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: R1650L

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159374

Predicted Effect

probably benign
Transcript: ENSMUST00000159676

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159982

Predicted Effect

probably benign
Transcript: ENSMUST00000160638

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162269

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175947

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176861

Predicted Effect

probably benign
Transcript: ENSMUST00000177143
AA Change: R1641L

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: R1641L

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,942,429	H1097N	possibly damaging	Het
Abcb1b	T	A	5: 8,821,436	V330E	possibly damaging	Het
Abcb5	A	G	12: 118,874,762	S1022P	probably damaging	Het
Abcc8	A	G	7: 46,179,813	I46T	probably damaging	Het
Add3	A	G	19: 53,233,678	R275G	probably damaging	Het
Akap1	C	A	11: 88,844,751	G362*	probably null	Het
Arhgef4	A	G	1: 34,723,945	T761A	unknown	Het
Asap1	A	T	15: 64,120,107	L751Q	probably damaging	Het
Atg2a	C	A	19: 6,250,616	P741H	probably damaging	Het
Atxn10	T	C	15: 85,359,474	I46T	possibly damaging	Het
BC049715	C	A	6: 136,840,092	A110E	probably damaging	Het
Btbd7	T	A	12: 102,788,090	T806S	possibly damaging	Het
Cdk4	C	A	10: 127,064,689	P108H	probably damaging	Het
Cep290	A	G	10: 100,572,101	T2391A	probably benign	Het
Col6a3	G	T	1: 90,801,376	A1281E	probably damaging	Het
Cpa5	A	T	6: 30,624,655	I165F	probably damaging	Het
Ctdp1	G	T	18: 80,450,213	Q356K	probably benign	Het
Ddx21	A	G	10: 62,598,590	M130T	unknown	Het
Epha5	T	G	5: 84,233,696	D432A	probably damaging	Het
Esr1	ACGCCGCCGCCGCCGCCGCCGCCGCCGCC	ACGCCGCCGCCGCCGCCGCCGCCGCC	10: 4,712,571		probably benign	Het
Fads2	A	T	19: 10,091,829	L77Q	probably benign	Het
Fbn2	A	T	18: 58,053,659	H1723Q	possibly damaging	Het
Fbxo42	C	T	4: 141,167,854	H43Y	probably benign	Het
Fry	A	G	5: 150,310,425	T121A	possibly damaging	Het
Gpr156	T	G	16: 37,988,542	S209A	probably damaging	Het
Hey2	T	C	10: 30,833,849	T303A	probably benign	Het
Hivep1	T	A	13: 42,157,140	M952K	probably benign	Het
Hrasls	C	A	16: 29,228,170	A147E	possibly damaging	Het
Hydin	C	T	8: 110,581,985	Q3968*	probably null	Het
Jup	T	C	11: 100,383,576	E96G	probably benign	Het
Kcnn1	A	G	8: 70,844,551	I504T	probably benign	Het
Klk1b9	T	C	7: 43,979,690	V174A	probably damaging	Het
Lama3	G	C	18: 12,549,227	M1083I	possibly damaging	Het
Lcmt2	A	G	2: 121,138,896	S569P	probably benign	Het
Lrfn2	T	C	17: 49,071,225	S445P	probably damaging	Het
Lrp3	C	A	7: 35,213,170	G31W	probably damaging	Het
Lrrc8b	T	C	5: 105,481,702	L638P	probably damaging	Het
Mief2	C	T	11: 60,730,943	T113M	probably benign	Het
Mrps2	T	C	2: 28,468,887	F76S	probably damaging	Het
Naca	A	G	10: 128,042,179		probably benign	Het
Ndst4	C	A	3: 125,561,450	R336S	probably damaging	Het
Nr1i3	CACTCAACACTAC	CAC	1: 171,217,141		probably null	Het
Nr5a1	T	A	2: 38,710,673	T29S	probably benign	Het
Olfr1111	C	T	2: 87,149,771	V297M	possibly damaging	Het
Olfr993	T	C	2: 85,414,874	I2V	probably benign	Het
Pald1	A	G	10: 61,341,285	F662S	possibly damaging	Het
Pdcd4	G	T	19: 53,909,243	A59S	probably damaging	Het
Pde4a	T	C	9: 21,192,592		probably null	Het
Pkd1	T	A	17: 24,595,132	S4159T	probably damaging	Het
Plec	G	T	15: 76,189,281	P308Q	probably damaging	Het
Pnkp	A	G	7: 44,860,402	S262G	possibly damaging	Het
Pou2f1	A	G	1: 165,891,830	V504A	probably damaging	Het
Prepl	G	A	17: 85,088,357	R66W	probably damaging	Het
Rasgrf2	T	C	13: 92,030,888	K226E	probably damaging	Het
Ror1	T	A	4: 100,412,109	F381L	probably benign	Het
Sbsn	C	T	7: 30,753,053	Q498*	probably null	Het
Scgb2b19	T	C	7: 33,278,555	I106V	probably benign	Het
Sf3a2	G	A	10: 80,804,206		probably benign	Het
Sis	T	C	3: 72,934,142	H780R	probably damaging	Het
Slc28a3	G	T	13: 58,558,575	C617*	probably null	Het
Slc44a1	T	A	4: 53,561,006	V574D	probably damaging	Het
Slc8a3	T	A	12: 81,315,986	T20S	probably damaging	Het
Stt3b	T	A	9: 115,254,927	I394F	probably damaging	Het
Ubap1l	T	A	9: 65,372,055	V212D	possibly damaging	Het
Ugt2b35	T	C	5: 87,001,031	V47A	probably benign	Het
Vmn2r114	A	G	17: 23,291,211	F765S	probably damaging	Het
Vps50	C	T	6: 3,517,852	Q97*	probably null	Het
Vsig10	A	G	5: 117,351,570	Q467R	probably damaging	Het
Wdsub1	T	G	2: 59,878,133	Y11S	probably damaging	Het
Zbtb11	T	G	16: 55,991,620		probably null	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	splice site	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
BB009:Plch1	UTSW	3	63701981	missense	probably benign	0.05
BB019:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2259:Plch1	UTSW	3	63697977	missense	possibly damaging	0.94
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4491:Plch1	UTSW	3	63740739	missense	probably damaging	1.00
R4589:Plch1	UTSW	3	63781507	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4701:Plch1	UTSW	3	63699496	splice site	probably null
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6315:Plch1	UTSW	3	63781390	nonsense	probably null
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6479:Plch1	UTSW	3	63744510	missense	probably benign	0.06
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	splice site	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
R7851:Plch1	UTSW	3	63698434	missense	probably damaging	0.99
R7853:Plch1	UTSW	3	63773647	missense	probably benign	0.44
R7932:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R7983:Plch1	UTSW	3	63707743	missense	probably damaging	1.00
R8057:Plch1	UTSW	3	63698136	missense	probably benign
R8066:Plch1	UTSW	3	63711057	nonsense	probably null
R8206:Plch1	UTSW	3	63702626	splice site	probably null
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGCACTCTATGACCCAAGCTGCTG -3'
(R):5'- AGTGGTCCTTAGAAGTAAACCGCCC -3'

Sequencing Primer
(F):5'- GCCCAGTATCATATTTCCTGACAATG -3'
(R):5'- TAAACCGCCCGCTCCTG -3'

Posted On

2014-03-14