Incidental Mutation 'R1437:Sis'
ID161277
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1437 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72934142 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 780 (H780R)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect probably damaging
Transcript: ENSMUST00000094190
AA Change: H780R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: H780R

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167334
AA Change: H780R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: H780R

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 splice site probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7381:Sis UTSW 3 72913292 splice site probably null
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
R7742:Sis UTSW 3 72925098 missense probably benign 0.19
R7813:Sis UTSW 3 72925468 missense probably benign 0.01
R7883:Sis UTSW 3 72920996 missense possibly damaging 0.78
R7899:Sis UTSW 3 72937251 missense probably damaging 1.00
R7915:Sis UTSW 3 72921138 missense probably damaging 0.99
R8020:Sis UTSW 3 72908965 critical splice donor site probably null
R8023:Sis UTSW 3 72952480 missense probably damaging 0.97
R8029:Sis UTSW 3 72921142 missense probably damaging 1.00
R8053:Sis UTSW 3 72949568 nonsense probably null
R8062:Sis UTSW 3 72920988 nonsense probably null
R8074:Sis UTSW 3 72917198 missense probably damaging 1.00
R8085:Sis UTSW 3 72907129 missense probably damaging 1.00
R8137:Sis UTSW 3 72889045 missense probably benign 0.22
R8349:Sis UTSW 3 72903651 missense probably damaging 1.00
R8354:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8366:Sis UTSW 3 72958233 missense probably damaging 1.00
R8449:Sis UTSW 3 72903651 missense probably damaging 1.00
R8454:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8515:Sis UTSW 3 72929409 missense probably benign 0.00
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Z1176:Sis UTSW 3 72904273 missense probably benign 0.05
Z1176:Sis UTSW 3 72943557 missense probably benign 0.25
Z1177:Sis UTSW 3 72909172 missense possibly damaging 0.88
Z1177:Sis UTSW 3 72910474 missense probably damaging 1.00
Z1177:Sis UTSW 3 72943569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGAGCCAGCCACTGTTATTCTTAG -3'
(R):5'- TCTGTTGAATAAGGAGCCATGCTGC -3'

Sequencing Primer
(F):5'- CTGTAAGTCCCCACATACAACG -3'
(R):5'- GCCATGCTGCAGATGAATAC -3'
Posted On2014-03-14