Mutagenetix > Incidental Mutations

Incidental Mutation 'R1437:Ror1'

161280

Institutional Source

Beutler Lab

Gene Symbol

Ror1

Ensembl Gene

ENSMUSG00000035305

Gene Name

receptor tyrosine kinase-like orphan receptor 1

Synonyms

2810404D04Rik, Ntrkr1

MMRRC Submission

039492-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1437 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100095791-100444765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100412109 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 381 (F381L)

Ref Sequence

ENSEMBL: ENSMUSP00000048171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039630]

Predicted Effect

probably benign
Transcript: ENSMUST00000039630
AA Change: F381L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: F381L

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	70	138	8.37e-15	SMART
Pfam:Fz	170	290	4.9e-13	PFAM
KR	311	393	7.57e-47	SMART
transmembrane domain	404	426	N/A	INTRINSIC
TyrKc	473	746	2.46e-137	SMART
low complexity region	753	762	N/A	INTRINSIC
low complexity region	817	828	N/A	INTRINSIC
low complexity region	849	864	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,942,429	H1097N	possibly damaging	Het
Abcb1b	T	A	5: 8,821,436	V330E	possibly damaging	Het
Abcb5	A	G	12: 118,874,762	S1022P	probably damaging	Het
Abcc8	A	G	7: 46,179,813	I46T	probably damaging	Het
Add3	A	G	19: 53,233,678	R275G	probably damaging	Het
Akap1	C	A	11: 88,844,751	G362*	probably null	Het
Arhgef4	A	G	1: 34,723,945	T761A	unknown	Het
Asap1	A	T	15: 64,120,107	L751Q	probably damaging	Het
Atg2a	C	A	19: 6,250,616	P741H	probably damaging	Het
Atxn10	T	C	15: 85,359,474	I46T	possibly damaging	Het
BC049715	C	A	6: 136,840,092	A110E	probably damaging	Het
Btbd7	T	A	12: 102,788,090	T806S	possibly damaging	Het
Cdk4	C	A	10: 127,064,689	P108H	probably damaging	Het
Cep290	A	G	10: 100,572,101	T2391A	probably benign	Het
Col6a3	G	T	1: 90,801,376	A1281E	probably damaging	Het
Cpa5	A	T	6: 30,624,655	I165F	probably damaging	Het
Ctdp1	G	T	18: 80,450,213	Q356K	probably benign	Het
Ddx21	A	G	10: 62,598,590	M130T	unknown	Het
Epha5	T	G	5: 84,233,696	D432A	probably damaging	Het
Esr1	ACGCCGCCGCCGCCGCCGCCGCCGCCGCC	ACGCCGCCGCCGCCGCCGCCGCCGCC	10: 4,712,571		probably benign	Het
Fads2	A	T	19: 10,091,829	L77Q	probably benign	Het
Fbn2	A	T	18: 58,053,659	H1723Q	possibly damaging	Het
Fbxo42	C	T	4: 141,167,854	H43Y	probably benign	Het
Fry	A	G	5: 150,310,425	T121A	possibly damaging	Het
Gpr156	T	G	16: 37,988,542	S209A	probably damaging	Het
Hey2	T	C	10: 30,833,849	T303A	probably benign	Het
Hivep1	T	A	13: 42,157,140	M952K	probably benign	Het
Hrasls	C	A	16: 29,228,170	A147E	possibly damaging	Het
Hydin	C	T	8: 110,581,985	Q3968*	probably null	Het
Jup	T	C	11: 100,383,576	E96G	probably benign	Het
Kcnn1	A	G	8: 70,844,551	I504T	probably benign	Het
Klk1b9	T	C	7: 43,979,690	V174A	probably damaging	Het
Lama3	G	C	18: 12,549,227	M1083I	possibly damaging	Het
Lcmt2	A	G	2: 121,138,896	S569P	probably benign	Het
Lrfn2	T	C	17: 49,071,225	S445P	probably damaging	Het
Lrp3	C	A	7: 35,213,170	G31W	probably damaging	Het
Lrrc8b	T	C	5: 105,481,702	L638P	probably damaging	Het
Mief2	C	T	11: 60,730,943	T113M	probably benign	Het
Mrps2	T	C	2: 28,468,887	F76S	probably damaging	Het
Naca	A	G	10: 128,042,179		probably benign	Het
Ndst4	C	A	3: 125,561,450	R336S	probably damaging	Het
Nr1i3	CACTCAACACTAC	CAC	1: 171,217,141		probably null	Het
Nr5a1	T	A	2: 38,710,673	T29S	probably benign	Het
Olfr1111	C	T	2: 87,149,771	V297M	possibly damaging	Het
Olfr993	T	C	2: 85,414,874	I2V	probably benign	Het
Pald1	A	G	10: 61,341,285	F662S	possibly damaging	Het
Pdcd4	G	T	19: 53,909,243	A59S	probably damaging	Het
Pde4a	T	C	9: 21,192,592		probably null	Het
Pkd1	T	A	17: 24,595,132	S4159T	probably damaging	Het
Plch1	C	A	3: 63,697,533	R1641L	probably benign	Het
Plec	G	T	15: 76,189,281	P308Q	probably damaging	Het
Pnkp	A	G	7: 44,860,402	S262G	possibly damaging	Het
Pou2f1	A	G	1: 165,891,830	V504A	probably damaging	Het
Prepl	G	A	17: 85,088,357	R66W	probably damaging	Het
Rasgrf2	T	C	13: 92,030,888	K226E	probably damaging	Het
Sbsn	C	T	7: 30,753,053	Q498*	probably null	Het
Scgb2b19	T	C	7: 33,278,555	I106V	probably benign	Het
Sf3a2	G	A	10: 80,804,206		probably benign	Het
Sis	T	C	3: 72,934,142	H780R	probably damaging	Het
Slc28a3	G	T	13: 58,558,575	C617*	probably null	Het
Slc44a1	T	A	4: 53,561,006	V574D	probably damaging	Het
Slc8a3	T	A	12: 81,315,986	T20S	probably damaging	Het
Stt3b	T	A	9: 115,254,927	I394F	probably damaging	Het
Ubap1l	T	A	9: 65,372,055	V212D	possibly damaging	Het
Ugt2b35	T	C	5: 87,001,031	V47A	probably benign	Het
Vmn2r114	A	G	17: 23,291,211	F765S	probably damaging	Het
Vps50	C	T	6: 3,517,852	Q97*	probably null	Het
Vsig10	A	G	5: 117,351,570	Q467R	probably damaging	Het
Wdsub1	T	G	2: 59,878,133	Y11S	probably damaging	Het
Zbtb11	T	G	16: 55,991,620		probably null	Het

Other mutations in Ror1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Ror1	APN	4	100333743	missense	probably damaging	1.00
IGL00939:Ror1	APN	4	100441226	missense	probably benign	0.01
IGL01408:Ror1	APN	4	100333787	missense	probably damaging	1.00
IGL01678:Ror1	APN	4	100425968	missense	possibly damaging	0.68
IGL01700:Ror1	APN	4	100409771	missense	probably damaging	1.00
IGL01985:Ror1	APN	4	100425964	missense	possibly damaging	0.94
IGL02002:Ror1	APN	4	100441184	missense	probably damaging	1.00
IGL02634:Ror1	APN	4	100426110	missense	probably benign	0.00
IGL02995:Ror1	APN	4	100334525	splice site	probably benign
IGL03033:Ror1	APN	4	100411895	missense	possibly damaging	0.67
IGL03207:Ror1	APN	4	100407945	splice site	probably null
F5770:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
R0256:Ror1	UTSW	4	100409745	missense	probably benign	0.20
R0417:Ror1	UTSW	4	100412000	missense	possibly damaging	0.94
R0525:Ror1	UTSW	4	100441520	missense	probably damaging	1.00
R1034:Ror1	UTSW	4	100333620	nonsense	probably null
R1278:Ror1	UTSW	4	100441878	missense	possibly damaging	0.69
R1368:Ror1	UTSW	4	100441137	missense	possibly damaging	0.94
R1441:Ror1	UTSW	4	100440983	missense	probably benign
R1544:Ror1	UTSW	4	100441986	missense	probably damaging	1.00
R1717:Ror1	UTSW	4	100302938	missense	probably benign
R1857:Ror1	UTSW	4	100441503	missense	probably damaging	1.00
R2018:Ror1	UTSW	4	100407841	nonsense	probably null
R2051:Ror1	UTSW	4	100407868	nonsense	probably null
R2127:Ror1	UTSW	4	100442093	missense	probably benign
R2132:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2133:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2176:Ror1	UTSW	4	100441874	missense	probably damaging	0.99
R2431:Ror1	UTSW	4	100441155	missense	probably damaging	1.00
R2896:Ror1	UTSW	4	100096280	missense	unknown
R3005:Ror1	UTSW	4	100441764	missense	probably damaging	0.99
R3780:Ror1	UTSW	4	100412117	missense	probably benign	0.34
R3850:Ror1	UTSW	4	100442160	missense	possibly damaging	0.90
R3861:Ror1	UTSW	4	100407923	missense	possibly damaging	0.46
R4599:Ror1	UTSW	4	100407910	missense	probably damaging	0.99
R4863:Ror1	UTSW	4	100409804	missense	probably damaging	0.99
R4871:Ror1	UTSW	4	100425998	missense	probably benign
R4990:Ror1	UTSW	4	100441964	missense	probably benign
R5023:Ror1	UTSW	4	100425932	missense	probably benign	0.01
R5028:Ror1	UTSW	4	100411936	missense	possibly damaging	0.67
R5079:Ror1	UTSW	4	100441422	missense	probably damaging	1.00
R5294:Ror1	UTSW	4	100425938	missense	probably benign	0.00
R5538:Ror1	UTSW	4	100441011	missense	probably benign
R6339:Ror1	UTSW	4	100411931	missense	possibly damaging	0.91
R6491:Ror1	UTSW	4	100409912	missense	possibly damaging	0.94
R6632:Ror1	UTSW	4	100442106	missense	probably benign
R6733:Ror1	UTSW	4	100426055	missense	probably benign
R7022:Ror1	UTSW	4	100407911	missense	probably damaging	1.00
R7054:Ror1	UTSW	4	100442239	missense	probably benign	0.00
R7121:Ror1	UTSW	4	100302945	missense	probably benign	0.00
R7350:Ror1	UTSW	4	100425943	missense	probably benign	0.00
R7492:Ror1	UTSW	4	100441059	missense	probably benign	0.22
R7502:Ror1	UTSW	4	100333630	missense	probably benign	0.03
R7531:Ror1	UTSW	4	100441191	missense	probably damaging	1.00
R7661:Ror1	UTSW	4	100441490	missense	probably damaging	1.00
R7822:Ror1	UTSW	4	100441367	missense	probably damaging	1.00
R7831:Ror1	UTSW	4	100441098	missense	probably benign	0.01
R8366:Ror1	UTSW	4	100409998	missense	possibly damaging	0.91
R8539:Ror1	UTSW	4	100441887	missense	possibly damaging	0.71
V7580:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
V7583:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
X0020:Ror1	UTSW	4	100426090	missense	probably benign	0.02
Z1177:Ror1	UTSW	4	100302919	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTTGCTAGGAAGGACAAATCCCC -3'
(R):5'- TGTCAGGAACTGTCAGACAGCTAGG -3'

Sequencing Primer
(F):5'- GGAAGGACAAATCCCCTTCTG -3'
(R):5'- TACGTGGGGACCTGGATATT -3'

Posted On

2014-03-14