Incidental Mutation 'R1437:Epha5'
ID161284
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1437 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84233696 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 432 (D432A)
Ref Sequence ENSEMBL: ENSMUSP00000109033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect probably benign
Transcript: ENSMUST00000053733
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113398
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113399
AA Change: D432A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: D432A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113401
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113403
AA Change: D432A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: D432A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113406
AA Change: D432A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: D432A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155469
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 splice site probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
R8043:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTAGATTCAATCGGCAGAGCAAAGTC -3'
(R):5'- ACTAGGGATTAGTATGGTCAAGGGCAAC -3'

Sequencing Primer
(F):5'- CTAAAATAATACAGTTGGGTTGGGC -3'
(R):5'- CTCGGAATGCCATCTCAAATG -3'
Posted On2014-03-14