Incidental Mutation 'R1437:Esr1'
ID161304
Institutional Source Beutler Lab
Gene Symbol Esr1
Ensembl Gene ENSMUSG00000019768
Gene Nameestrogen receptor 1 (alpha)
SynonymsERalpha, ERa, ER[a], Estra, Nr3a1, ESR, ER-alpha, Estr
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R1437 (G1)
Quality Score116
Status Not validated
Chromosome10
Chromosomal Location4611593-5005614 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACGCCGCCGCCGCCGCCGCCGCCGCCGCC to ACGCCGCCGCCGCCGCCGCCGCCGCC at 4712571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067086] [ENSMUST00000105588] [ENSMUST00000105589] [ENSMUST00000105590]
Predicted Effect probably benign
Transcript: ENSMUST00000067086
SMART Domains Protein: ENSMUSP00000070070
Gene: ENSMUSG00000019768

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105588
SMART Domains Protein: ENSMUSP00000101213
Gene: ENSMUSG00000019768

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 1.7e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 493 4.19e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105589
SMART Domains Protein: ENSMUSP00000101214
Gene: ENSMUSG00000019768

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 2.3e-64 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105590
SMART Domains Protein: ENSMUSP00000101215
Gene: ENSMUSG00000019768

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149195
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an estrogen receptor, a member of the nuclear hormone family of intracellular receptors. The encoded protein, activated by the sex hormone estrogen, is a transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Similar genes in human have been implicated in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for targeted null mutations have reduced skeletal growth and are infertile. Females exhibit hypoplastic uteri and nonovulatory ovaries, while males produce few sperm of low motility and fertilizing capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Esr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Esr1 APN 10 4997890 missense probably benign 0.00
IGL01886:Esr1 APN 10 4856861 missense probably damaging 0.98
IGL02174:Esr1 APN 10 4998003 missense probably damaging 1.00
IGL02625:Esr1 APN 10 5001346 missense probably benign 0.00
IGL02938:Esr1 APN 10 4783872 missense probably damaging 1.00
IGL03232:Esr1 APN 10 4969270 missense probably damaging 1.00
cybernetic UTSW 10 4783874 missense probably damaging 1.00
terminatrix UTSW 10 4746760 missense probably damaging 1.00
R0280:Esr1 UTSW 10 4856951 missense probably benign 0.05
R0280:Esr1 UTSW 10 4939289 missense probably damaging 0.99
R0479:Esr1 UTSW 10 4997911 missense probably damaging 1.00
R0943:Esr1 UTSW 10 4746781 missense probably damaging 1.00
R1581:Esr1 UTSW 10 4997905 missense probably damaging 1.00
R1644:Esr1 UTSW 10 5001380 missense probably benign 0.00
R1647:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1648:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1791:Esr1 UTSW 10 4783913 missense probably damaging 1.00
R1955:Esr1 UTSW 10 4857125 missense probably damaging 1.00
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R4323:Esr1 UTSW 10 5001307 missense possibly damaging 0.48
R4727:Esr1 UTSW 10 5001418 missense probably benign 0.00
R5009:Esr1 UTSW 10 4712394 missense probably damaging 1.00
R5578:Esr1 UTSW 10 4969164 missense probably damaging 1.00
R5610:Esr1 UTSW 10 5001221 missense probably damaging 1.00
R5836:Esr1 UTSW 10 4712817 missense probably benign 0.02
R5938:Esr1 UTSW 10 4966245 intron probably benign
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6173:Esr1 UTSW 10 4746760 missense probably damaging 1.00
R6575:Esr1 UTSW 10 4966301 intron probably benign
R6888:Esr1 UTSW 10 4857076 missense probably benign 0.00
R7271:Esr1 UTSW 10 4783874 missense probably damaging 1.00
R7310:Esr1 UTSW 10 4939259 missense probably damaging 1.00
R7552:Esr1 UTSW 10 4856903 missense probably damaging 1.00
X0011:Esr1 UTSW 10 4712571 small deletion probably benign
X0018:Esr1 UTSW 10 5001325 missense probably benign
Z1088:Esr1 UTSW 10 4712667 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TTGCTGCACCAGATCCAAGGGAAC -3'
(R):5'- TGTCTCTCCCACAAGACAGCTACAG -3'

Sequencing Primer
(F):5'- CAGATCCAAGGGAACGAGCTG -3'
(R):5'- ttgttgttgttgttgttgttgttg -3'
Posted On2014-03-14