Incidental Mutation 'R1437:Atxn10'
ID161329
Institutional Source Beutler Lab
Gene Symbol Atxn10
Ensembl Gene ENSMUSG00000016541
Gene Nameataxin 10
SynonymsTEG-169, Sca10, E46, Tex169
MMRRC Submission 039492-MU
Accession Numbers

Genbank: NM_016843: MGI: 1859293

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1437 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85336245-85463212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85359474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Ref Sequence ENSEMBL: ENSMUSP00000132450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163242
AA Change: I46T

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132450
Gene: ENSMUSG00000016541
AA Change: I46T

DomainStartEndE-ValueType
Pfam:Atx10homo_assoc 370 467 4.7e-38 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die at early postimplantation stages. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Gene trapped(20)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Atxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn10 APN 15 85336465 start codon destroyed probably benign 0.33
IGL01020:Atxn10 APN 15 85375422 splice site probably null
IGL01380:Atxn10 APN 15 85376695 nonsense probably null
IGL01408:Atxn10 APN 15 85376695 nonsense probably null
3-1:Atxn10 UTSW 15 85438094 splice site probably benign
R0190:Atxn10 UTSW 15 85336529 missense possibly damaging 0.84
R0319:Atxn10 UTSW 15 85365282 missense probably damaging 1.00
R1746:Atxn10 UTSW 15 85376663 missense probably damaging 1.00
R2050:Atxn10 UTSW 15 85365312 missense probably benign 0.37
R3055:Atxn10 UTSW 15 85387005 missense probably benign 0.03
R4559:Atxn10 UTSW 15 85438120 missense possibly damaging 0.81
R4786:Atxn10 UTSW 15 85387143 missense probably benign 0.03
R4799:Atxn10 UTSW 15 85376708 splice site probably null
R4831:Atxn10 UTSW 15 85387059 missense probably benign 0.01
R5323:Atxn10 UTSW 15 85391743 missense probably benign 0.00
R5335:Atxn10 UTSW 15 85336584 splice site probably null
R5355:Atxn10 UTSW 15 85462314 missense probably damaging 1.00
R5768:Atxn10 UTSW 15 85393420 missense probably benign 0.01
R6260:Atxn10 UTSW 15 85462411 missense probably benign 0.38
R6277:Atxn10 UTSW 15 85391692 missense probably benign 0.05
R6370:Atxn10 UTSW 15 85393385 missense probably damaging 1.00
R6645:Atxn10 UTSW 15 85376703 critical splice donor site probably null
R6957:Atxn10 UTSW 15 85336498 missense probably damaging 1.00
R7859:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R7942:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R8031:Atxn10 UTSW 15 85393393 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCTCTCGTGTGTAAAGTTTGCTG -3'
(R):5'- CTCAGAAGAGCGTGTGTCACTACC -3'

Sequencing Primer
(F):5'- tgtaaaatggagagagaggatagtg -3'
(R):5'- CGTGTGTCACTACCTGATGG -3'
Posted On2014-03-14