Mutagenetix > Incidental Mutations

Incidental Mutation 'R1437:Ctdp1'

161340

Institutional Source

Beutler Lab

Gene Symbol

Ctdp1

Ensembl Gene

ENSMUSG00000033323

Gene Name

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1

Synonyms

4930563P03Rik

MMRRC Submission

039492-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.911) question?

Stock #

R1437 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80407959-80469695 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80450213 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 356 (Q356K)

Ref Sequence

ENSEMBL: ENSMUSP00000038938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036229]

Predicted Effect

probably benign
Transcript: ENSMUST00000036229
AA Change: Q356K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323
AA Change: Q356K

Domain	Start	End	E-Value	Type
low complexity region	55	72	N/A	INTRINSIC
CPDc	181	327	1.21e-62	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
BRCT	621	708	9.62e-7	SMART
low complexity region	779	787	N/A	INTRINSIC
low complexity region	879	889	N/A	INTRINSIC
PDB:1ONV\|B	890	921	2e-6	PDB
coiled coil region	936	959	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,942,429	H1097N	possibly damaging	Het
Abcb1b	T	A	5: 8,821,436	V330E	possibly damaging	Het
Abcb5	A	G	12: 118,874,762	S1022P	probably damaging	Het
Abcc8	A	G	7: 46,179,813	I46T	probably damaging	Het
Add3	A	G	19: 53,233,678	R275G	probably damaging	Het
Akap1	C	A	11: 88,844,751	G362*	probably null	Het
Arhgef4	A	G	1: 34,723,945	T761A	unknown	Het
Asap1	A	T	15: 64,120,107	L751Q	probably damaging	Het
Atg2a	C	A	19: 6,250,616	P741H	probably damaging	Het
Atxn10	T	C	15: 85,359,474	I46T	possibly damaging	Het
BC049715	C	A	6: 136,840,092	A110E	probably damaging	Het
Btbd7	T	A	12: 102,788,090	T806S	possibly damaging	Het
Cdk4	C	A	10: 127,064,689	P108H	probably damaging	Het
Cep290	A	G	10: 100,572,101	T2391A	probably benign	Het
Col6a3	G	T	1: 90,801,376	A1281E	probably damaging	Het
Cpa5	A	T	6: 30,624,655	I165F	probably damaging	Het
Ddx21	A	G	10: 62,598,590	M130T	unknown	Het
Epha5	T	G	5: 84,233,696	D432A	probably damaging	Het
Esr1	ACGCCGCCGCCGCCGCCGCCGCCGCCGCC	ACGCCGCCGCCGCCGCCGCCGCCGCC	10: 4,712,571		probably benign	Het
Fads2	A	T	19: 10,091,829	L77Q	probably benign	Het
Fbn2	A	T	18: 58,053,659	H1723Q	possibly damaging	Het
Fbxo42	C	T	4: 141,167,854	H43Y	probably benign	Het
Fry	A	G	5: 150,310,425	T121A	possibly damaging	Het
Gpr156	T	G	16: 37,988,542	S209A	probably damaging	Het
Hey2	T	C	10: 30,833,849	T303A	probably benign	Het
Hivep1	T	A	13: 42,157,140	M952K	probably benign	Het
Hrasls	C	A	16: 29,228,170	A147E	possibly damaging	Het
Hydin	C	T	8: 110,581,985	Q3968*	probably null	Het
Jup	T	C	11: 100,383,576	E96G	probably benign	Het
Kcnn1	A	G	8: 70,844,551	I504T	probably benign	Het
Klk1b9	T	C	7: 43,979,690	V174A	probably damaging	Het
Lama3	G	C	18: 12,549,227	M1083I	possibly damaging	Het
Lcmt2	A	G	2: 121,138,896	S569P	probably benign	Het
Lrfn2	T	C	17: 49,071,225	S445P	probably damaging	Het
Lrp3	C	A	7: 35,213,170	G31W	probably damaging	Het
Lrrc8b	T	C	5: 105,481,702	L638P	probably damaging	Het
Mief2	C	T	11: 60,730,943	T113M	probably benign	Het
Mrps2	T	C	2: 28,468,887	F76S	probably damaging	Het
Naca	A	G	10: 128,042,179		probably benign	Het
Ndst4	C	A	3: 125,561,450	R336S	probably damaging	Het
Nr1i3	CACTCAACACTAC	CAC	1: 171,217,141		probably null	Het
Nr5a1	T	A	2: 38,710,673	T29S	probably benign	Het
Olfr1111	C	T	2: 87,149,771	V297M	possibly damaging	Het
Olfr993	T	C	2: 85,414,874	I2V	probably benign	Het
Pald1	A	G	10: 61,341,285	F662S	possibly damaging	Het
Pdcd4	G	T	19: 53,909,243	A59S	probably damaging	Het
Pde4a	T	C	9: 21,192,592		probably null	Het
Pkd1	T	A	17: 24,595,132	S4159T	probably damaging	Het
Plch1	C	A	3: 63,697,533	R1641L	probably benign	Het
Plec	G	T	15: 76,189,281	P308Q	probably damaging	Het
Pnkp	A	G	7: 44,860,402	S262G	possibly damaging	Het
Pou2f1	A	G	1: 165,891,830	V504A	probably damaging	Het
Prepl	G	A	17: 85,088,357	R66W	probably damaging	Het
Rasgrf2	T	C	13: 92,030,888	K226E	probably damaging	Het
Ror1	T	A	4: 100,412,109	F381L	probably benign	Het
Sbsn	C	T	7: 30,753,053	Q498*	probably null	Het
Scgb2b19	T	C	7: 33,278,555	I106V	probably benign	Het
Sf3a2	G	A	10: 80,804,206		probably benign	Het
Sis	T	C	3: 72,934,142	H780R	probably damaging	Het
Slc28a3	G	T	13: 58,558,575	C617*	probably null	Het
Slc44a1	T	A	4: 53,561,006	V574D	probably damaging	Het
Slc8a3	T	A	12: 81,315,986	T20S	probably damaging	Het
Stt3b	T	A	9: 115,254,927	I394F	probably damaging	Het
Ubap1l	T	A	9: 65,372,055	V212D	possibly damaging	Het
Ugt2b35	T	C	5: 87,001,031	V47A	probably benign	Het
Vmn2r114	A	G	17: 23,291,211	F765S	probably damaging	Het
Vps50	C	T	6: 3,517,852	Q97*	probably null	Het
Vsig10	A	G	5: 117,351,570	Q467R	probably damaging	Het
Wdsub1	T	G	2: 59,878,133	Y11S	probably damaging	Het
Zbtb11	T	G	16: 55,991,620		probably null	Het

Other mutations in Ctdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Ctdp1	APN	18	80458692	splice site	probably null
IGL01695:Ctdp1	APN	18	80449626	missense	probably damaging	1.00
IGL01865:Ctdp1	APN	18	80455984	missense	probably damaging	1.00
IGL02009:Ctdp1	APN	18	80455972	missense	probably damaging	1.00
IGL02419:Ctdp1	APN	18	80420584	missense	probably damaging	1.00
IGL02580:Ctdp1	APN	18	80450090	missense	probably benign	0.01
IGL02699:Ctdp1	APN	18	80450185	missense	probably benign
IGL03117:Ctdp1	APN	18	80449501	missense	probably damaging	0.98
IGL03301:Ctdp1	APN	18	80449634	nonsense	probably null
IGL03385:Ctdp1	APN	18	80449918	missense	probably damaging	1.00
R0370:Ctdp1	UTSW	18	80449354	missense	probably damaging	1.00
R0374:Ctdp1	UTSW	18	80447422	critical splice donor site	probably null
R0730:Ctdp1	UTSW	18	80450242	missense	probably benign	0.00
R0894:Ctdp1	UTSW	18	80469521	missense	probably benign	0.09
R1187:Ctdp1	UTSW	18	80449487	missense	probably damaging	1.00
R1988:Ctdp1	UTSW	18	80449401	missense	possibly damaging	0.89
R2192:Ctdp1	UTSW	18	80449481	missense	probably benign	0.30
R3709:Ctdp1	UTSW	18	80450213	nonsense	probably null
R3724:Ctdp1	UTSW	18	80459267	missense	probably benign	0.16
R3756:Ctdp1	UTSW	18	80452351	missense	probably damaging	0.98
R4297:Ctdp1	UTSW	18	80449957	missense	probably benign
R4298:Ctdp1	UTSW	18	80449957	missense	probably benign
R4640:Ctdp1	UTSW	18	80451154	critical splice donor site	probably null
R4841:Ctdp1	UTSW	18	80408726	missense	unknown
R4842:Ctdp1	UTSW	18	80408726	missense	unknown
R5007:Ctdp1	UTSW	18	80420480	missense	probably damaging	0.99
R5055:Ctdp1	UTSW	18	80456088	missense	probably damaging	1.00
R5219:Ctdp1	UTSW	18	80447460	missense	probably damaging	1.00
R5870:Ctdp1	UTSW	18	80408686	missense	unknown
R5896:Ctdp1	UTSW	18	80458788	missense	probably damaging	1.00
R6242:Ctdp1	UTSW	18	80459212	missense	probably damaging	1.00
R6255:Ctdp1	UTSW	18	80459297	critical splice acceptor site	probably null
R6300:Ctdp1	UTSW	18	80459240	missense	probably benign	0.26
R6431:Ctdp1	UTSW	18	80451255	missense	probably damaging	0.96
R6462:Ctdp1	UTSW	18	80420474	missense	probably damaging	0.98
R6512:Ctdp1	UTSW	18	80451263	missense	probably damaging	1.00
R6537:Ctdp1	UTSW	18	80449551	missense	probably benign
R6802:Ctdp1	UTSW	18	80420441	critical splice donor site	probably null
R7477:Ctdp1	UTSW	18	80440714	splice site	probably null
R8121:Ctdp1	UTSW	18	80456008	missense	probably damaging	1.00
R8348:Ctdp1	UTSW	18	80450110	missense	probably benign	0.00
R8350:Ctdp1	UTSW	18	80469279	missense	probably benign	0.03
R8513:Ctdp1	UTSW	18	80449463	missense	possibly damaging	0.49
X0020:Ctdp1	UTSW	18	80449990	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGCTGGACAGGTCAAAGTCCAAATC -3'
(R):5'- AACACCTTGCCCACATAGGCTG -3'

Sequencing Primer
(F):5'- TCAAAGTCCAAATCCTGGGTG -3'
(R):5'- TCAGGCAGAAGGTCTGTGC -3'

Posted On

2014-03-14