Incidental Mutation 'R1437:Atg2a'
ID161341
Institutional Source Beutler Lab
Gene Symbol Atg2a
Ensembl Gene ENSMUSG00000024773
Gene Nameautophagy related 2A
Synonyms
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R1437 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6241668-6262335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6250616 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 741 (P741H)
Ref Sequence ENSEMBL: ENSMUSP00000046412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045351]
Predicted Effect probably damaging
Transcript: ENSMUST00000045351
AA Change: P741H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: P741H

DomainStartEndE-ValueType
Pfam:Chorein_N 14 131 7.6e-20 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
low complexity region 852 863 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
low complexity region 1429 1446 N/A INTRINSIC
low complexity region 1761 1773 N/A INTRINSIC
Pfam:ATG_C 1814 1908 2.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135018
Predicted Effect unknown
Transcript: ENSMUST00000145600
AA Change: P542H
SMART Domains Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: P542H

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 871 883 N/A INTRINSIC
low complexity region 1233 1250 N/A INTRINSIC
low complexity region 1565 1577 N/A INTRINSIC
Pfam:ATG_C 1618 1712 3.6e-32 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Atg2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Atg2a APN 19 6254599 missense probably damaging 1.00
IGL01612:Atg2a APN 19 6252484 missense probably benign 0.03
IGL02105:Atg2a APN 19 6250403 splice site probably benign
IGL02151:Atg2a APN 19 6255757 missense possibly damaging 0.95
IGL02228:Atg2a APN 19 6246800 missense probably benign 0.29
IGL02329:Atg2a APN 19 6249929 critical splice donor site probably null
IGL02408:Atg2a APN 19 6241828 nonsense probably null
IGL02538:Atg2a APN 19 6257628 missense probably benign
IGL02830:Atg2a APN 19 6247681 missense probably benign 0.04
IGL03349:Atg2a APN 19 6258024 missense possibly damaging 0.77
PIT4515001:Atg2a UTSW 19 6253585 missense probably damaging 1.00
R0099:Atg2a UTSW 19 6252789 missense probably damaging 0.97
R0212:Atg2a UTSW 19 6246554 missense probably damaging 1.00
R0365:Atg2a UTSW 19 6247683 missense possibly damaging 0.51
R0398:Atg2a UTSW 19 6246578 missense probably damaging 1.00
R0483:Atg2a UTSW 19 6256601 missense probably damaging 0.98
R0483:Atg2a UTSW 19 6256602 missense probably benign 0.01
R0494:Atg2a UTSW 19 6253377 missense probably damaging 1.00
R0511:Atg2a UTSW 19 6252539 missense possibly damaging 0.89
R0590:Atg2a UTSW 19 6245007 unclassified probably benign
R0592:Atg2a UTSW 19 6245007 unclassified probably benign
R0593:Atg2a UTSW 19 6245007 unclassified probably benign
R0630:Atg2a UTSW 19 6244517 missense probably damaging 0.99
R1306:Atg2a UTSW 19 6253021 missense probably benign 0.31
R1539:Atg2a UTSW 19 6246771 synonymous probably null
R1774:Atg2a UTSW 19 6250598 missense probably benign 0.01
R1781:Atg2a UTSW 19 6256213 missense probably damaging 0.96
R1854:Atg2a UTSW 19 6252431 missense probably benign 0.11
R1884:Atg2a UTSW 19 6254384 missense probably damaging 1.00
R1899:Atg2a UTSW 19 6245067 missense probably damaging 1.00
R1935:Atg2a UTSW 19 6252536 missense probably damaging 1.00
R2020:Atg2a UTSW 19 6250269 critical splice donor site probably null
R2071:Atg2a UTSW 19 6257458 missense probably benign 0.00
R2513:Atg2a UTSW 19 6258046 critical splice donor site probably null
R3808:Atg2a UTSW 19 6252816 missense possibly damaging 0.71
R4065:Atg2a UTSW 19 6258366 missense probably damaging 1.00
R4109:Atg2a UTSW 19 6258374 missense possibly damaging 0.95
R4352:Atg2a UTSW 19 6257457 missense probably benign 0.04
R4440:Atg2a UTSW 19 6255829 critical splice donor site probably null
R4472:Atg2a UTSW 19 6258955 missense probably damaging 0.98
R4669:Atg2a UTSW 19 6258987 critical splice donor site probably null
R4878:Atg2a UTSW 19 6250244 missense probably damaging 1.00
R4926:Atg2a UTSW 19 6257533 missense probably damaging 0.96
R5237:Atg2a UTSW 19 6246814 missense probably benign
R5350:Atg2a UTSW 19 6251338 missense probably damaging 0.99
R5507:Atg2a UTSW 19 6245070 missense possibly damaging 0.94
R5732:Atg2a UTSW 19 6257460 missense probably damaging 1.00
R5784:Atg2a UTSW 19 6261505 missense probably damaging 1.00
R5960:Atg2a UTSW 19 6254360 missense probably damaging 1.00
R5985:Atg2a UTSW 19 6254637 missense probably damaging 1.00
R6175:Atg2a UTSW 19 6241729 unclassified probably benign
R6572:Atg2a UTSW 19 6254665 missense probably damaging 0.98
R6878:Atg2a UTSW 19 6250178 missense probably damaging 0.99
R6879:Atg2a UTSW 19 6251852 missense possibly damaging 0.70
R6983:Atg2a UTSW 19 6260040 missense probably damaging 0.99
R7024:Atg2a UTSW 19 6250219 missense possibly damaging 0.88
R7217:Atg2a UTSW 19 6253441 critical splice donor site probably null
R7384:Atg2a UTSW 19 6261677 missense probably damaging 1.00
R7387:Atg2a UTSW 19 6255168 missense possibly damaging 0.79
R7425:Atg2a UTSW 19 6255652 missense probably benign 0.02
R7512:Atg2a UTSW 19 6260076 missense probably damaging 1.00
R7658:Atg2a UTSW 19 6251263 missense probably damaging 1.00
R7893:Atg2a UTSW 19 6251296 missense probably damaging 1.00
R7976:Atg2a UTSW 19 6251296 missense probably damaging 1.00
R8062:Atg2a UTSW 19 6252579 critical splice donor site probably null
X0065:Atg2a UTSW 19 6258196 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTCCCCTCCAGGAATCTACGAAG -3'
(R):5'- CAGTCCCATAAATGGTGCCCACAG -3'

Sequencing Primer
(F):5'- TGGAGAGAAGCCACCAGTC -3'
(R):5'- TGCCCACAGTGGGAAAGTC -3'
Posted On2014-03-14