Mutagenetix > Incidental Mutations

Incidental Mutation 'R1428:Rab3gap2'

161376

Institutional Source

Beutler Lab

Gene Symbol

Rab3gap2

Ensembl Gene

ENSMUSG00000039318

Gene Name

RAB3 GTPase activating protein subunit 2

Synonyms

1110059F07Rik

MMRRC Submission

039484-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1428 (G1)

Quality Score

105

Status

Validated

Chromosome

Chromosomal Location

185204117-185286759 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 185247904 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 340 (A340T)

Ref Sequence

ENSEMBL: ENSMUSP00000141608 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069652
AA Change: A340T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: A340T

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-167	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	767	1366	3.2e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193245

Predicted Effect

probably damaging
Transcript: ENSMUST00000194740
AA Change: A340T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: A340T

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-157	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	766	1346	2.5e-233	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196796

Meta Mutation Damage Score

0.2177

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2410089E03Rik	T	A	15: 8,219,369	Y1801N	possibly damaging	Het
Abl1	G	T	2: 31,801,810	A1114S	probably damaging	Het
Acbd5	T	C	2: 23,099,721	V452A	probably damaging	Het
Armc12	A	G	17: 28,537,936	D225G	probably damaging	Het
Atad3a	T	A	4: 155,755,682	Q121H	probably damaging	Het
Bptf	T	A	11: 107,073,047	I1711F	probably damaging	Het
C2cd4c	A	T	10: 79,612,230	I361N	probably damaging	Het
Canx	A	G	11: 50,308,394		probably benign	Het
Ccdc127	C	T	13: 74,356,915	T194I	probably benign	Het
Cdc42ep3	T	C	17: 79,335,036	K152E	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cnbd2	T	C	2: 156,339,284		probably null	Het
Crybg1	T	C	10: 43,975,078	N1599S	probably benign	Het
Cyc1	T	C	15: 76,344,348	V59A	probably benign	Het
Cyp2j11	T	C	4: 96,294,880	K484E	probably benign	Het
Ddx60	T	C	8: 61,958,159		probably benign	Het
Epg5	T	C	18: 77,962,427	S711P	probably damaging	Het
Espl1	A	T	15: 102,305,685	Q649L	probably benign	Het
Eya1	G	A	1: 14,304,414		probably benign	Het
Fam214a	A	T	9: 75,006,321	T79S	probably benign	Het
Fam71e2	T	A	7: 4,757,688	H675L	possibly damaging	Het
Fat2	T	A	11: 55,296,087	Y1311F	probably damaging	Het
Gins4	T	C	8: 23,227,128	Y208C	probably damaging	Het
Gsk3b	T	C	16: 38,090,575	V17A	probably benign	Het
Gykl1	A	T	18: 52,694,761	K347I	probably benign	Het
Helz	T	A	11: 107,592,840		probably benign	Het
Hivep3	C	T	4: 120,096,575	T696I	possibly damaging	Het
Ifi27l2a	G	T	12: 103,442,834		probably benign	Het
Kif13a	A	G	13: 46,791,511		probably benign	Het
Kpna3	C	T	14: 61,383,220		probably benign	Het
Mmp15	C	G	8: 95,369,562	P327R	probably benign	Het
Mrc1	A	T	2: 14,315,263	T1003S	probably benign	Het
Mtss1	T	C	15: 58,947,390	D393G	probably benign	Het
Olfm4	T	A	14: 80,021,403	Y331N	probably damaging	Het
Olfr1255	G	C	2: 89,816,381	L12F	probably damaging	Het
Olfr517	T	A	7: 108,868,960	N65Y	probably damaging	Het
P2rx3	G	C	2: 85,024,950	T54R	possibly damaging	Het
Pacsin1	C	T	17: 27,705,963	T217I	probably damaging	Het
Phlpp1	A	G	1: 106,380,425		probably null	Het
Pknox1	T	C	17: 31,592,092		probably benign	Het
Plb1	A	G	5: 32,264,912	R70G	possibly damaging	Het
Rnf103	T	A	6: 71,508,999	W205R	probably damaging	Het
Rps6kc1	G	A	1: 190,798,726	T936M	probably damaging	Het
Spef2	T	C	15: 9,596,707		probably benign	Het
Sstr4	A	G	2: 148,396,359	S297G	probably benign	Het
Timm8a1	C	T	X: 134,538,123	E93K	probably benign	Het
Uck1	A	C	2: 32,258,355	Y150D	probably damaging	Het
Yipf4	A	G	17: 74,498,305		probably benign	Het

Other mutations in Rab3gap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Rab3gap2	APN	1	185238870	missense	probably damaging	1.00
IGL01620:Rab3gap2	APN	1	185204326	missense	probably benign
IGL01977:Rab3gap2	APN	1	185267023	nonsense	probably null
IGL02183:Rab3gap2	APN	1	185271468	nonsense	probably null
IGL02229:Rab3gap2	APN	1	185259383	missense	possibly damaging	0.71
IGL02231:Rab3gap2	APN	1	185266898	splice site	probably benign
IGL02506:Rab3gap2	APN	1	185252024	splice site	probably benign
IGL02618:Rab3gap2	APN	1	185251741	missense	possibly damaging	0.79
IGL02643:Rab3gap2	APN	1	185267000	missense	possibly damaging	0.69
IGL03239:Rab3gap2	APN	1	185249894	missense	probably damaging	1.00
PIT4498001:Rab3gap2	UTSW	1	185281685	missense	probably damaging	1.00
R0173:Rab3gap2	UTSW	1	185249907	missense	possibly damaging	0.51
R0372:Rab3gap2	UTSW	1	185262694	missense	possibly damaging	0.93
R0492:Rab3gap2	UTSW	1	185252392	splice site	probably benign
R0510:Rab3gap2	UTSW	1	185260508	splice site	probably benign
R0708:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R0711:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R1135:Rab3gap2	UTSW	1	185275943	missense	possibly damaging	0.95
R1599:Rab3gap2	UTSW	1	185251026	missense	probably benign	0.07
R1758:Rab3gap2	UTSW	1	185283884	missense	probably benign	0.13
R1903:Rab3gap2	UTSW	1	185221902	missense	probably benign
R1929:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R1994:Rab3gap2	UTSW	1	185236024	missense	probably damaging	1.00
R2010:Rab3gap2	UTSW	1	185278281	missense	possibly damaging	0.57
R2102:Rab3gap2	UTSW	1	185282389	missense	probably benign	0.00
R2120:Rab3gap2	UTSW	1	185261367	missense	possibly damaging	0.95
R2219:Rab3gap2	UTSW	1	185275916	missense	probably damaging	0.99
R2259:Rab3gap2	UTSW	1	185221859	missense	probably damaging	1.00
R2270:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R2272:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R3083:Rab3gap2	UTSW	1	185204269	missense	probably benign	0.00
R3776:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R4050:Rab3gap2	UTSW	1	185272643	critical splice donor site	probably null
R4130:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R4176:Rab3gap2	UTSW	1	185246666	missense	probably damaging	0.99
R4296:Rab3gap2	UTSW	1	185255837	critical splice donor site	probably null
R4416:Rab3gap2	UTSW	1	185282347	missense	probably benign	0.00
R4426:Rab3gap2	UTSW	1	185235342	missense	probably damaging	1.00
R4516:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4518:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4891:Rab3gap2	UTSW	1	185259366	missense	probably benign	0.00
R4913:Rab3gap2	UTSW	1	185262829	missense	probably benign	0.12
R4955:Rab3gap2	UTSW	1	185267155	intron	probably benign
R5411:Rab3gap2	UTSW	1	185277145	critical splice acceptor site	probably null
R5516:Rab3gap2	UTSW	1	185235487	missense	probably benign	0.02
R5670:Rab3gap2	UTSW	1	185221899	missense	probably benign
R5670:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R6380:Rab3gap2	UTSW	1	185235984	missense	probably damaging	1.00
R6533:Rab3gap2	UTSW	1	185232954	splice site	probably null
R6655:Rab3gap2	UTSW	1	185250011	missense	probably damaging	1.00
R6676:Rab3gap2	UTSW	1	185283410	missense	probably damaging	1.00
R6726:Rab3gap2	UTSW	1	185247865	missense	probably damaging	0.99
R6969:Rab3gap2	UTSW	1	185236012	missense	probably damaging	1.00
R7151:Rab3gap2	UTSW	1	185248053	missense	probably benign	0.00
R7168:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R7196:Rab3gap2	UTSW	1	185281667	missense	probably damaging	1.00
R7201:Rab3gap2	UTSW	1	185267191	missense	probably damaging	1.00
R7371:Rab3gap2	UTSW	1	185251068	missense	probably damaging	1.00
R7573:Rab3gap2	UTSW	1	185282382	missense	probably benign
R7779:Rab3gap2	UTSW	1	185259444	missense	probably damaging	0.98
R7913:Rab3gap2	UTSW	1	185262816	missense	possibly damaging	0.88
R7922:Rab3gap2	UTSW	1	185249920	missense	probably benign	0.00
R8115:Rab3gap2	UTSW	1	185267250	missense	possibly damaging	0.90
R8203:Rab3gap2	UTSW	1	185267179	missense	probably damaging	1.00
R8242:Rab3gap2	UTSW	1	185221853	missense	probably benign
R8322:Rab3gap2	UTSW	1	185246680	missense	probably benign	0.42
R8360:Rab3gap2	UTSW	1	185267073	intron	probably benign
R8515:Rab3gap2	UTSW	1	185262820	missense	probably benign	0.15
Z1088:Rab3gap2	UTSW	1	185281677	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATGCGGAGTTCTTGCTTCCCAG -3'
(R):5'- AAAAGCATGGCGGACTTGCCTCAC -3'

Sequencing Primer
(F):5'- CATTGCTGAGGCCAAAGTACTG -3'
(R):5'- GACTTGCCTCACAGCTAGTG -3'

Posted On

2014-03-14