Incidental Mutation 'R1428:Acbd5'
ID161379
Institutional Source Beutler Lab
Gene Symbol Acbd5
Ensembl Gene ENSMUSG00000026781
Gene Nameacyl-Coenzyme A binding domain containing 5
Synonyms
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location23068167-23115558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23099721 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 452 (V452A)
Ref Sequence ENSEMBL: ENSMUSP00000154043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028121] [ENSMUST00000114523] [ENSMUST00000114526] [ENSMUST00000114529] [ENSMUST00000155602] [ENSMUST00000226571] [ENSMUST00000227663] [ENSMUST00000227809] [ENSMUST00000228050]
Predicted Effect probably damaging
Transcript: ENSMUST00000028121
AA Change: V405A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028121
Gene: ENSMUSG00000026781
AA Change: V405A

DomainStartEndE-ValueType
Pfam:ACBP 8 96 3.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 392 414 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114523
AA Change: V405A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110169
Gene: ENSMUSG00000026781
AA Change: V405A

DomainStartEndE-ValueType
Pfam:ACBP 8 96 2.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 393 415 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114526
AA Change: V440A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110172
Gene: ENSMUSG00000026781
AA Change: V440A

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 44 132 4.7e-35 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 428 450 N/A INTRINSIC
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114529
AA Change: V441A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110175
Gene: ENSMUSG00000026781
AA Change: V441A

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 45 129 4.9e-30 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 429 451 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155602
AA Change: V416A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117325
Gene: ENSMUSG00000026781
AA Change: V416A

DomainStartEndE-ValueType
Pfam:ACBP 8 96 3.5e-36 PFAM
low complexity region 117 130 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226252
Predicted Effect probably damaging
Transcript: ENSMUST00000226571
AA Change: V451A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227612
Predicted Effect probably damaging
Transcript: ENSMUST00000227663
AA Change: V415A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227809
AA Change: V404A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000228050
AA Change: V452A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228856
Meta Mutation Damage Score 0.2153 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-Coenzyme A binding protein family, known to function in the transport and distribution of long chain acyl-Coenzyme A in cells. This gene may play a role in the differentiation of megakaryocytes and formation of platelets. A related protein in yeast is involved in autophagy of peroxisomes. A mutation in this gene has been associated with autosomal dominant thrombocytopenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Acbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Acbd5 APN 2 23078169 missense probably damaging 1.00
IGL02343:Acbd5 APN 2 23087495 missense possibly damaging 0.89
IGL03087:Acbd5 APN 2 23089710 missense probably benign
R0723:Acbd5 UTSW 2 23069596 missense probably damaging 1.00
R1610:Acbd5 UTSW 2 23090551 missense probably damaging 1.00
R1623:Acbd5 UTSW 2 23094344 missense probably damaging 1.00
R2918:Acbd5 UTSW 2 23099567 missense probably benign 0.00
R4736:Acbd5 UTSW 2 23099584 missense probably damaging 0.96
R5369:Acbd5 UTSW 2 23112510 missense probably damaging 0.96
R6207:Acbd5 UTSW 2 23069478 missense possibly damaging 0.58
R6599:Acbd5 UTSW 2 23069080 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCACATTTGAGCGAAGGACCCAAG -3'
(R):5'- GGCACCCATCTTTTAAGCCAGTCTC -3'

Sequencing Primer
(F):5'- CCCAAGGGTCGGCAAGTAG -3'
(R):5'- AGCCAGTCTCTTCTTAAACAATATG -3'
Posted On2014-03-14