Incidental Mutation 'R1428:P2rx3'
ID 161382
Institutional Source Beutler Lab
Gene Symbol P2rx3
Ensembl Gene ENSMUSG00000027071
Gene Name purinergic receptor P2X, ligand-gated ion channel, 3
Synonyms 4930513E20Rik, P2X3
MMRRC Submission 039484-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1428 (G1)
Quality Score 206
Status Validated
Chromosome 2
Chromosomal Location 84998583-85037462 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 85024950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Arginine at position 54 (T54R)
Ref Sequence ENSEMBL: ENSMUSP00000107243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028465] [ENSMUST00000111613] [ENSMUST00000111616]
AlphaFold Q3UR32
Predicted Effect possibly damaging
Transcript: ENSMUST00000028465
AA Change: T54R

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028465
Gene: ENSMUSG00000027071
AA Change: T54R

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 367 1.6e-151 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111613
AA Change: T54R

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071
AA Change: T54R

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111616
AA Change: T54R

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107243
Gene: ENSMUSG00000027071
AA Change: T54R

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 91 1.2e-32 PFAM
Pfam:P2X_receptor 86 350 3.3e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145285
Meta Mutation Damage Score 0.5651 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and may transduce ATP-evoked nociceptor activation. Mouse studies suggest that this receptor is important for peripheral pain responses, and also participates in pathways controlling urinary bladder volume reflexes. It is possible that the development of selective antagonists for this receptor may have a therapeutic potential in pain relief and in the treatment of disorders of urine storage. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show normal ventilatory responses to hypoxia. Mice homozygous for a reporter allele show loss of rapidly desensitizing ATP-gated cation currents in dorsal root ganglion neurons, reduced formalin-evoked pain behavior, and enhanced thermal hyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in P2rx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:P2rx3 APN 2 85035272 missense probably damaging 1.00
IGL01775:P2rx3 APN 2 85024157 missense probably benign
IGL01897:P2rx3 APN 2 85023481 critical splice donor site probably benign
IGL02399:P2rx3 APN 2 85023227 missense probably benign
R0928:P2rx3 UTSW 2 85035298 start codon destroyed probably null 0.98
R1537:P2rx3 UTSW 2 85023481 critical splice donor site probably null
R1678:P2rx3 UTSW 2 85022467 missense possibly damaging 0.90
R4332:P2rx3 UTSW 2 85024861 missense probably benign 0.25
R4897:P2rx3 UTSW 2 85024926 missense probably damaging 1.00
R5052:P2rx3 UTSW 2 84999024 missense probably benign 0.01
R5903:P2rx3 UTSW 2 85000727 missense possibly damaging 0.93
R5917:P2rx3 UTSW 2 85035247 missense probably damaging 1.00
R6614:P2rx3 UTSW 2 85035199 missense probably damaging 1.00
R8250:P2rx3 UTSW 2 85022391 missense probably damaging 1.00
R8512:P2rx3 UTSW 2 85024411 missense probably damaging 0.98
R8953:P2rx3 UTSW 2 85023498 missense possibly damaging 0.61
R9237:P2rx3 UTSW 2 85023552 missense probably benign 0.02
Z1177:P2rx3 UTSW 2 85022476 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGGTCACCATTAAAACACAGGCAGG -3'
(R):5'- CTTTTCCACATGGCACATGCTGG -3'

Sequencing Primer
(F):5'- GGAGTCTAGCTTCTTGATATCCAG -3'
(R):5'- GGGTTTGAAGATCCTCTGAACTAAG -3'
Posted On 2014-03-14