Mutagenetix > Incidental Mutations

Incidental Mutation 'R1428:Sstr4'

161384

Institutional Source

Beutler Lab

Gene Symbol

Sstr4

Ensembl Gene

ENSMUSG00000037014

Gene Name

somatostatin receptor 4

Synonyms

Smstr4, sst4

MMRRC Submission

039484-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R1428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148395344-148396767 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148396359 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 297 (S297G)

Ref Sequence

ENSEMBL: ENSMUSP00000105588 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109962]

Predicted Effect

probably benign
Transcript: ENSMUST00000109962
AA Change: S297G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: S297G

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	55	323	4.7e-16	PFAM
Pfam:7tm_1	61	308	2.2e-61	PFAM
Pfam:7TM_GPCR_Srv	117	325	1.8e-10	PFAM
Pfam:7TM_GPCR_Srw	203	326	8.1e-9	PFAM

Meta Mutation Damage Score

0.2395

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2410089E03Rik	T	A	15: 8,219,369	Y1801N	possibly damaging	Het
Abl1	G	T	2: 31,801,810	A1114S	probably damaging	Het
Acbd5	T	C	2: 23,099,721	V452A	probably damaging	Het
Armc12	A	G	17: 28,537,936	D225G	probably damaging	Het
Atad3a	T	A	4: 155,755,682	Q121H	probably damaging	Het
Bptf	T	A	11: 107,073,047	I1711F	probably damaging	Het
C2cd4c	A	T	10: 79,612,230	I361N	probably damaging	Het
Canx	A	G	11: 50,308,394		probably benign	Het
Ccdc127	C	T	13: 74,356,915	T194I	probably benign	Het
Cdc42ep3	T	C	17: 79,335,036	K152E	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cnbd2	T	C	2: 156,339,284		probably null	Het
Crybg1	T	C	10: 43,975,078	N1599S	probably benign	Het
Cyc1	T	C	15: 76,344,348	V59A	probably benign	Het
Cyp2j11	T	C	4: 96,294,880	K484E	probably benign	Het
Ddx60	T	C	8: 61,958,159		probably benign	Het
Epg5	T	C	18: 77,962,427	S711P	probably damaging	Het
Espl1	A	T	15: 102,305,685	Q649L	probably benign	Het
Eya1	G	A	1: 14,304,414		probably benign	Het
Fam214a	A	T	9: 75,006,321	T79S	probably benign	Het
Fam71e2	T	A	7: 4,757,688	H675L	possibly damaging	Het
Fat2	T	A	11: 55,296,087	Y1311F	probably damaging	Het
Gins4	T	C	8: 23,227,128	Y208C	probably damaging	Het
Gsk3b	T	C	16: 38,090,575	V17A	probably benign	Het
Gykl1	A	T	18: 52,694,761	K347I	probably benign	Het
Helz	T	A	11: 107,592,840		probably benign	Het
Hivep3	C	T	4: 120,096,575	T696I	possibly damaging	Het
Ifi27l2a	G	T	12: 103,442,834		probably benign	Het
Kif13a	A	G	13: 46,791,511		probably benign	Het
Kpna3	C	T	14: 61,383,220		probably benign	Het
Mmp15	C	G	8: 95,369,562	P327R	probably benign	Het
Mrc1	A	T	2: 14,315,263	T1003S	probably benign	Het
Mtss1	T	C	15: 58,947,390	D393G	probably benign	Het
Olfm4	T	A	14: 80,021,403	Y331N	probably damaging	Het
Olfr1255	G	C	2: 89,816,381	L12F	probably damaging	Het
Olfr517	T	A	7: 108,868,960	N65Y	probably damaging	Het
P2rx3	G	C	2: 85,024,950	T54R	possibly damaging	Het
Pacsin1	C	T	17: 27,705,963	T217I	probably damaging	Het
Phlpp1	A	G	1: 106,380,425		probably null	Het
Pknox1	T	C	17: 31,592,092		probably benign	Het
Plb1	A	G	5: 32,264,912	R70G	possibly damaging	Het
Rab3gap2	G	A	1: 185,247,904	A340T	probably damaging	Het
Rnf103	T	A	6: 71,508,999	W205R	probably damaging	Het
Rps6kc1	G	A	1: 190,798,726	T936M	probably damaging	Het
Spef2	T	C	15: 9,596,707		probably benign	Het
Timm8a1	C	T	X: 134,538,123	E93K	probably benign	Het
Uck1	A	C	2: 32,258,355	Y150D	probably damaging	Het
Yipf4	A	G	17: 74,498,305		probably benign	Het

Other mutations in Sstr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Sstr4	APN	2	148395552	missense	probably benign	0.00
IGL01536:Sstr4	APN	2	148395880	missense	probably damaging	1.00
IGL02210:Sstr4	APN	2	148396309	missense	probably damaging	1.00
IGL02670:Sstr4	APN	2	148396533	nonsense	probably null
R0396:Sstr4	UTSW	2	148396261	missense	probably damaging	1.00
R1839:Sstr4	UTSW	2	148395533	missense	probably benign	0.21
R2332:Sstr4	UTSW	2	148396410	missense	probably damaging	1.00
R2943:Sstr4	UTSW	2	148396165	missense	probably damaging	0.96
R3700:Sstr4	UTSW	2	148396353	missense	possibly damaging	0.57
R5502:Sstr4	UTSW	2	148395551	small insertion	probably benign
R5503:Sstr4	UTSW	2	148395551	small insertion	probably benign
R5596:Sstr4	UTSW	2	148395732	missense	possibly damaging	0.65
R5726:Sstr4	UTSW	2	148396083	missense	probably damaging	1.00
R6985:Sstr4	UTSW	2	148396249	missense	probably damaging	0.97
X0022:Sstr4	UTSW	2	148395532	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTACCTGCTTATTGTGGGCAAG -3'
(R):5'- TGAAAGGGCCTGGCTTAGTGAAAAC -3'

Sequencing Primer
(F):5'- CTTATTGTGGGCAAGATGCG -3'
(R):5'- AAGGGACTTGCTTGCAGC -3'

Posted On

2014-03-14