Incidental Mutation 'R1428:Sstr4'
ID 161384
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Name somatostatin receptor 4
Synonyms Smstr4, sst4
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R1428 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 148395344-148396767 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148396359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 297 (S297G)
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109962
AA Change: S297G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: S297G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Meta Mutation Damage Score 0.2395 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148395552 missense probably benign 0.00
IGL01536:Sstr4 APN 2 148395880 missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148396309 missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148396533 nonsense probably null
R0396:Sstr4 UTSW 2 148396261 missense probably damaging 1.00
R1839:Sstr4 UTSW 2 148395533 missense probably benign 0.21
R2332:Sstr4 UTSW 2 148396410 missense probably damaging 1.00
R2943:Sstr4 UTSW 2 148396165 missense probably damaging 0.96
R3700:Sstr4 UTSW 2 148396353 missense possibly damaging 0.57
R5502:Sstr4 UTSW 2 148395551 small insertion probably benign
R5503:Sstr4 UTSW 2 148395551 small insertion probably benign
R5596:Sstr4 UTSW 2 148395732 missense possibly damaging 0.65
R5726:Sstr4 UTSW 2 148396083 missense probably damaging 1.00
R6985:Sstr4 UTSW 2 148396249 missense probably damaging 0.97
R8939:Sstr4 UTSW 2 148396308 missense probably damaging 1.00
R8943:Sstr4 UTSW 2 148395862 missense possibly damaging 0.94
X0022:Sstr4 UTSW 2 148395532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTACCTGCTTATTGTGGGCAAG -3'
(R):5'- TGAAAGGGCCTGGCTTAGTGAAAAC -3'

Sequencing Primer
(F):5'- CTTATTGTGGGCAAGATGCG -3'
(R):5'- AAGGGACTTGCTTGCAGC -3'
Posted On 2014-03-14