Incidental Mutation 'R1428:Cnbd2'
Institutional Source Beutler Lab
Gene Symbol Cnbd2
Ensembl Gene ENSMUSG00000038085
Gene Namecyclic nucleotide binding domain containing 2
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosomal Location156312299-156375638 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 156339284 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037096] [ENSMUST00000073942] [ENSMUST00000109580]
Predicted Effect probably null
Transcript: ENSMUST00000037096
SMART Domains Protein: ENSMUSP00000041268
Gene: ENSMUSG00000038085

low complexity region 45 68 N/A INTRINSIC
cNMP 206 332 1.78e-7 SMART
Blast:cNMP 376 443 4e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000073942
SMART Domains Protein: ENSMUSP00000073598
Gene: ENSMUSG00000038085

cNMP 89 215 1.78e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109580
SMART Domains Protein: ENSMUSP00000105208
Gene: ENSMUSG00000038085

cNMP 77 203 1.78e-7 SMART
Blast:cNMP 247 314 3e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154227
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility associated with impaired spermiogenesis and development of flagellum bending. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Cnbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Cnbd2 APN 2 156312614 unclassified probably benign
IGL01472:Cnbd2 APN 2 156375348 missense probably damaging 1.00
IGL01738:Cnbd2 APN 2 156375617 utr 3 prime probably benign
IGL01825:Cnbd2 APN 2 156338709 missense probably damaging 1.00
IGL03001:Cnbd2 APN 2 156333634 critical splice donor site probably null
IGL03057:Cnbd2 APN 2 156367672 missense possibly damaging 0.80
R1006:Cnbd2 UTSW 2 156328408 missense possibly damaging 0.86
R1080:Cnbd2 UTSW 2 156339273 missense probably benign 0.28
R1592:Cnbd2 UTSW 2 156335402 missense probably benign 0.30
R1601:Cnbd2 UTSW 2 156333631 missense probably damaging 0.98
R1637:Cnbd2 UTSW 2 156373724 missense probably damaging 1.00
R2259:Cnbd2 UTSW 2 156335272 missense probably damaging 1.00
R2352:Cnbd2 UTSW 2 156335355 missense probably damaging 1.00
R4106:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4109:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4479:Cnbd2 UTSW 2 156333653 intron probably benign
R4857:Cnbd2 UTSW 2 156367565 missense probably benign 0.01
R4893:Cnbd2 UTSW 2 156365184 missense probably damaging 0.97
R4899:Cnbd2 UTSW 2 156339221 missense probably benign 0.00
R5070:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R5446:Cnbd2 UTSW 2 156367661 missense possibly damaging 0.95
R5784:Cnbd2 UTSW 2 156338657 missense probably damaging 1.00
R6197:Cnbd2 UTSW 2 156375574 missense possibly damaging 0.86
R7009:Cnbd2 UTSW 2 156320034 missense probably benign 0.00
R7221:Cnbd2 UTSW 2 156373661 missense probably benign 0.01
R7577:Cnbd2 UTSW 2 156328376 missense possibly damaging 0.93
R7699:Cnbd2 UTSW 2 156375406 missense probably benign 0.00
R8146:Cnbd2 UTSW 2 156328361 missense probably damaging 1.00
X0002:Cnbd2 UTSW 2 156338697 missense probably benign 0.22
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggtttggtttggtttggtttttc -3'
Posted On2014-03-14