Mutagenetix > Incidental Mutation

Incidental Mutation 'R1428:Plb1'

161389

Institutional Source

Beutler Lab

Gene Symbol

Plb1

Ensembl Gene

ENSMUSG00000029134

Gene Name

phospholipase B1

Synonyms

4930539A06Rik, 4632413E21Rik, 4930433E17Rik

MMRRC Submission

039484-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R1428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32232708-32366520 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32264912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 70 (R70G)

Ref Sequence

ENSEMBL: ENSMUSP00000144040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202201] [ENSMUST00000202220]

AlphaFold

Q3TTY0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101376
AA Change: R70G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: R70G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201313

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202201
AA Change: R70G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144401
Gene: ENSMUSG00000029134
AA Change: R70G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	1.3e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202220
AA Change: R70G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: R70G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202886

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2410089E03Rik	T	A	15: 8,219,369	Y1801N	possibly damaging	Het
Abl1	G	T	2: 31,801,810	A1114S	probably damaging	Het
Acbd5	T	C	2: 23,099,721	V452A	probably damaging	Het
Armc12	A	G	17: 28,537,936	D225G	probably damaging	Het
Atad3a	T	A	4: 155,755,682	Q121H	probably damaging	Het
Bptf	T	A	11: 107,073,047	I1711F	probably damaging	Het
C2cd4c	A	T	10: 79,612,230	I361N	probably damaging	Het
Canx	A	G	11: 50,308,394		probably benign	Het
Ccdc127	C	T	13: 74,356,915	T194I	probably benign	Het
Cdc42ep3	T	C	17: 79,335,036	K152E	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cnbd2	T	C	2: 156,339,284		probably null	Het
Crybg1	T	C	10: 43,975,078	N1599S	probably benign	Het
Cyc1	T	C	15: 76,344,348	V59A	probably benign	Het
Cyp2j11	T	C	4: 96,294,880	K484E	probably benign	Het
Ddx60	T	C	8: 61,958,159		probably benign	Het
Epg5	T	C	18: 77,962,427	S711P	probably damaging	Het
Espl1	A	T	15: 102,305,685	Q649L	probably benign	Het
Eya1	G	A	1: 14,304,414		probably benign	Het
Fam214a	A	T	9: 75,006,321	T79S	probably benign	Het
Fam71e2	T	A	7: 4,757,688	H675L	possibly damaging	Het
Fat2	T	A	11: 55,296,087	Y1311F	probably damaging	Het
Gins4	T	C	8: 23,227,128	Y208C	probably damaging	Het
Gsk3b	T	C	16: 38,090,575	V17A	probably benign	Het
Gykl1	A	T	18: 52,694,761	K347I	probably benign	Het
Helz	T	A	11: 107,592,840		probably benign	Het
Hivep3	C	T	4: 120,096,575	T696I	possibly damaging	Het
Ifi27l2a	G	T	12: 103,442,834		probably benign	Het
Kif13a	A	G	13: 46,791,511		probably benign	Het
Kpna3	C	T	14: 61,383,220		probably benign	Het
Mmp15	C	G	8: 95,369,562	P327R	probably benign	Het
Mrc1	A	T	2: 14,315,263	T1003S	probably benign	Het
Mtss1	T	C	15: 58,947,390	D393G	probably benign	Het
Olfm4	T	A	14: 80,021,403	Y331N	probably damaging	Het
Olfr1255	G	C	2: 89,816,381	L12F	probably damaging	Het
Olfr517	T	A	7: 108,868,960	N65Y	probably damaging	Het
P2rx3	G	C	2: 85,024,950	T54R	possibly damaging	Het
Pacsin1	C	T	17: 27,705,963	T217I	probably damaging	Het
Phlpp1	A	G	1: 106,380,425		probably null	Het
Pknox1	T	C	17: 31,592,092		probably benign	Het
Rab3gap2	G	A	1: 185,247,904	A340T	probably damaging	Het
Rnf103	T	A	6: 71,508,999	W205R	probably damaging	Het
Rps6kc1	G	A	1: 190,798,726	T936M	probably damaging	Het
Spef2	T	C	15: 9,596,707		probably benign	Het
Sstr4	A	G	2: 148,396,359	S297G	probably benign	Het
Timm8a1	C	T	X: 134,538,123	E93K	probably benign	Het
Uck1	A	C	2: 32,258,355	Y150D	probably damaging	Het
Yipf4	A	G	17: 74,498,305		probably benign	Het

Other mutations in Plb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Plb1	APN	5	32345736	missense	probably benign	0.00
IGL00542:Plb1	APN	5	32269834	missense	probably benign	0.02
IGL00835:Plb1	APN	5	32364172	missense	unknown
IGL00954:Plb1	APN	5	32298514	splice site	probably benign
IGL01350:Plb1	APN	5	32317064	missense	probably damaging	1.00
IGL01527:Plb1	APN	5	32317123	missense	probably damaging	1.00
IGL01599:Plb1	APN	5	32342544	splice site	probably benign
IGL01690:Plb1	APN	5	32313697	missense	probably damaging	1.00
IGL01813:Plb1	APN	5	32329085	missense	probably damaging	1.00
IGL01826:Plb1	APN	5	32281145	missense	probably damaging	0.99
IGL02263:Plb1	APN	5	32321348	splice site	probably benign
IGL02314:Plb1	APN	5	32281148	missense	possibly damaging	0.93
IGL02649:Plb1	APN	5	32362568	missense	probably benign	0.09
IGL02701:Plb1	APN	5	32364197	missense	unknown
IGL02704:Plb1	APN	5	32353667	missense	probably benign	0.03
IGL03170:Plb1	APN	5	32284902	missense	probably damaging	0.99
IGL03182:Plb1	APN	5	32344915	splice site	probably benign
IGL03326:Plb1	APN	5	32331327	missense	probably benign	0.00
IGL03046:Plb1	UTSW	5	32328412	missense	probably damaging	1.00
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0330:Plb1	UTSW	5	32355357	missense	probably damaging	1.00
R0413:Plb1	UTSW	5	32355362	missense	probably damaging	1.00
R0721:Plb1	UTSW	5	32364195	missense	unknown
R0735:Plb1	UTSW	5	32284920	missense	possibly damaging	0.90
R1423:Plb1	UTSW	5	32293257	missense	probably benign
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1694:Plb1	UTSW	5	32317277	missense	probably null	0.01
R1801:Plb1	UTSW	5	32293243	missense	probably damaging	1.00
R1804:Plb1	UTSW	5	32353697	missense	possibly damaging	0.91
R1900:Plb1	UTSW	5	32286847	missense	probably benign	0.44
R1903:Plb1	UTSW	5	32291238	missense	probably damaging	1.00
R2101:Plb1	UTSW	5	32349660	missense	probably damaging	1.00
R2153:Plb1	UTSW	5	32314089	missense	probably damaging	1.00
R2207:Plb1	UTSW	5	32316640	missense	possibly damaging	0.50
R2270:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2271:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2311:Plb1	UTSW	5	32269818	missense	probably benign	0.01
R2850:Plb1	UTSW	5	32293224	missense	probably benign
R3103:Plb1	UTSW	5	32328029	missense	possibly damaging	0.92
R4444:Plb1	UTSW	5	32330565	missense	probably benign	0.06
R4559:Plb1	UTSW	5	32332831	missense	probably damaging	0.99
R4577:Plb1	UTSW	5	32247557	nonsense	probably null
R4578:Plb1	UTSW	5	32247557	nonsense	probably null
R4739:Plb1	UTSW	5	32349679	splice site	probably null
R4747:Plb1	UTSW	5	32349659	missense	probably benign	0.08
R4806:Plb1	UTSW	5	32289852	missense	probably damaging	1.00
R5406:Plb1	UTSW	5	32341915	missense	probably damaging	1.00
R5567:Plb1	UTSW	5	32364199	missense	unknown
R5574:Plb1	UTSW	5	32329947	missense	probably benign	0.13
R5588:Plb1	UTSW	5	32329949	critical splice donor site	probably null
R5619:Plb1	UTSW	5	32333497	missense	probably damaging	0.99
R5769:Plb1	UTSW	5	32317522	missense	probably benign	0.05
R6366:Plb1	UTSW	5	32314085	missense	possibly damaging	0.59
R6700:Plb1	UTSW	5	32333464	missense	probably damaging	0.99
R7162:Plb1	UTSW	5	32349663	missense	probably benign	0.30
R7379:Plb1	UTSW	5	32345639	missense	probably damaging	1.00
R7395:Plb1	UTSW	5	32353684	missense	probably benign	0.30
R7426:Plb1	UTSW	5	32321247	splice site	probably null
R7643:Plb1	UTSW	5	32247557	nonsense	probably null
R7657:Plb1	UTSW	5	32329867	missense	probably damaging	0.98
R7780:Plb1	UTSW	5	32326266	splice site	probably null
R8040:Plb1	UTSW	5	32273069	missense	possibly damaging	0.89
R8212:Plb1	UTSW	5	32264906	missense	probably damaging	1.00
R8312:Plb1	UTSW	5	32328485	missense	probably damaging	1.00
R8560:Plb1	UTSW	5	32302679	missense	possibly damaging	0.95
R8770:Plb1	UTSW	5	32247509	missense	unknown
R8857:Plb1	UTSW	5	32364212	missense	unknown
R9029:Plb1	UTSW	5	32281735	missense	probably damaging	0.99
R9110:Plb1	UTSW	5	32364058	missense	probably benign	0.00
R9765:Plb1	UTSW	5	32355387	missense	probably damaging	1.00
X0018:Plb1	UTSW	5	32285883	missense	probably benign	0.01
X0019:Plb1	UTSW	5	32353697	missense	probably damaging	0.99
X0027:Plb1	UTSW	5	32270358	missense	probably benign
X0028:Plb1	UTSW	5	32302675	missense	probably damaging	1.00
Z1088:Plb1	UTSW	5	32310917	missense	probably benign
Z1088:Plb1	UTSW	5	32310847	missense	probably damaging	0.99
Z1177:Plb1	UTSW	5	32284897	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GGGTTCCAGGATTCCCAGTAAGTACAG -3'
(R):5'- GGCACATACAATGCTTTCTCCCAAATG -3'

Sequencing Primer
(F):5'- TAGGCATTCTCTGCCTACCT -3'
(R):5'- ccttctgcccccacatc -3'

Posted On

2014-03-14