Incidental Mutation 'R1428:Rnf103'
ID161390
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Namering finger protein 103
SynonymsZfp103, kf-1
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71493894-71510881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71508999 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 205 (W205R)
Ref Sequence ENSEMBL: ENSMUSP00000109817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
Predicted Effect probably damaging
Transcript: ENSMUST00000064637
AA Change: W205R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: W205R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114178
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114179
AA Change: W205R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: W205R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150069
Meta Mutation Damage Score 0.8479 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71509749 missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71509083 missense probably benign 0.00
IGL01601:Rnf103 APN 6 71509183 missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71510382 missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71509564 missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71510188 missense probably benign 0.01
IGL02386:Rnf103 APN 6 71509218 missense probably benign
IGL02532:Rnf103 APN 6 71509825 missense probably benign 0.19
IGL02532:Rnf103 APN 6 71509652 missense probably damaging 0.96
IGL02747:Rnf103 APN 6 71509177 missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71509705 missense probably benign 0.41
IGL03247:Rnf103 APN 6 71510305 missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71509331 missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71509702 missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71509582 missense probably damaging 0.96
R2362:Rnf103 UTSW 6 71510017 missense probably benign 0.08
R3847:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3849:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3919:Rnf103 UTSW 6 71510347 missense probably benign 0.08
R4914:Rnf103 UTSW 6 71510264 missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71510008 missense probably benign 0.04
R5634:Rnf103 UTSW 6 71509617 missense probably benign 0.01
R5682:Rnf103 UTSW 6 71508724 intron probably benign
R5791:Rnf103 UTSW 6 71508925 missense probably damaging 0.99
R5994:Rnf103 UTSW 6 71496910 missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71505824 missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71510365 missense probably damaging 1.00
R7739:Rnf103 UTSW 6 71509479 missense possibly damaging 0.77
R7819:Rnf103 UTSW 6 71508930 missense probably benign 0.00
R7903:Rnf103 UTSW 6 71509154 missense probably damaging 1.00
R7986:Rnf103 UTSW 6 71509154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACAGTTGCCAAGTATTGGTCTC -3'
(R):5'- CCACAAATCGCTTGATGGTTGCTC -3'

Sequencing Primer
(F):5'- GAACGTAAGTTGTTCAACAGCCTC -3'
(R):5'- GCCTGAAGGGATATAAATTCACCTG -3'
Posted On2014-03-14