Incidental Mutation 'R1428:Fam71e2'
ID161392
Institutional Source Beutler Lab
Gene Symbol Fam71e2
Ensembl Gene ENSMUSG00000092518
Gene Namefamily with sequence similarity 71, member E2
Synonyms
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4753226-4771302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4757688 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 675 (H675L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063324] [ENSMUST00000163574] [ENSMUST00000174409] [ENSMUST00000182048] [ENSMUST00000182111] [ENSMUST00000182173] [ENSMUST00000182738] [ENSMUST00000183334] [ENSMUST00000183971] [ENSMUST00000184143]
Predicted Effect probably benign
Transcript: ENSMUST00000063324
SMART Domains Protein: ENSMUSP00000064988
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108580
AA Change: H675L

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134691
Gene: ENSMUSG00000092518
AA Change: H675L

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:DUF3699 99 172 6.5e-23 PFAM
low complexity region 282 296 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163574
SMART Domains Protein: ENSMUSP00000137684
Gene: ENSMUSG00000092518

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174409
AA Change: H675L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133885
Gene: ENSMUSG00000092518
AA Change: H675L

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:DUF3699 93 168 5.8e-24 PFAM
low complexity region 277 291 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182048
SMART Domains Protein: ENSMUSP00000138765
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182111
SMART Domains Protein: ENSMUSP00000138709
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182173
SMART Domains Protein: ENSMUSP00000138288
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 74 5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182738
SMART Domains Protein: ENSMUSP00000138744
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 74 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183334
Predicted Effect probably benign
Transcript: ENSMUST00000183971
SMART Domains Protein: ENSMUSP00000138911
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 75 1.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184143
SMART Domains Protein: ENSMUSP00000139239
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 60 2.1e-11 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Fam71e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Fam71e2 APN 7 4757527 missense probably damaging 0.99
IGL01622:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01623:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01944:Fam71e2 APN 7 4770695 missense possibly damaging 0.94
IGL03013:Fam71e2 APN 7 4758633 missense probably benign 0.14
IGL03029:Fam71e2 APN 7 4757840 missense possibly damaging 0.78
R0153:Fam71e2 UTSW 7 4770287 missense probably damaging 0.99
R0523:Fam71e2 UTSW 7 4759393 missense possibly damaging 0.74
R0981:Fam71e2 UTSW 7 4757589 unclassified probably null
R1736:Fam71e2 UTSW 7 4758154 missense probably damaging 1.00
R1929:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R1993:Fam71e2 UTSW 7 4758018 missense probably damaging 1.00
R2016:Fam71e2 UTSW 7 4759398 missense probably damaging 1.00
R2256:Fam71e2 UTSW 7 4771021 missense probably benign 0.01
R2270:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2271:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2272:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R4288:Fam71e2 UTSW 7 4770723 missense possibly damaging 0.91
R4653:Fam71e2 UTSW 7 4758055 missense possibly damaging 0.95
R4812:Fam71e2 UTSW 7 4759072 missense probably damaging 1.00
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R5037:Fam71e2 UTSW 7 4758576 missense possibly damaging 0.64
R5044:Fam71e2 UTSW 7 4758661 missense probably benign 0.00
R5491:Fam71e2 UTSW 7 4757926 missense probably benign 0.05
R5559:Fam71e2 UTSW 7 4758450 missense probably damaging 1.00
R5919:Fam71e2 UTSW 7 4770386 missense possibly damaging 0.92
R6025:Fam71e2 UTSW 7 4758144 missense probably benign 0.01
R6038:Fam71e2 UTSW 7 4753595 unclassified probably null
R6038:Fam71e2 UTSW 7 4753595 unclassified probably null
R6164:Fam71e2 UTSW 7 4770678 missense probably damaging 0.99
R6371:Fam71e2 UTSW 7 4759359 missense probably benign 0.06
R6470:Fam71e2 UTSW 7 4757851 missense probably benign 0.16
R6546:Fam71e2 UTSW 7 4758465 missense probably benign 0.06
R6603:Fam71e2 UTSW 7 4758432 missense possibly damaging 0.95
R7037:Fam71e2 UTSW 7 4758585 utr 3 prime probably benign
R7381:Fam71e2 UTSW 7 4757682 missense
Predicted Primers PCR Primer
(F):5'- TCGTCCAAACCTAAGATAGGCCCAG -3'
(R):5'- TTTGCCACTACCAAGAAGCAGTCC -3'

Sequencing Primer
(F):5'- GAAAGTACCTGGCAAGTCCTCTG -3'
(R):5'- AGTTAGAAGACTGTGCCCAC -3'
Posted On2014-03-14