Incidental Mutation 'R1428:Gins4'
ID 161394
Institutional Source Beutler Lab
Gene Symbol Gins4
Ensembl Gene ENSMUSG00000031546
Gene Name GINS complex subunit 4
Synonyms 2810037C03Rik, SLD5, 4933405K01Rik
MMRRC Submission 039484-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1428 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 23716632-23727675 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23717144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 208 (Y208C)
Ref Sequence ENSEMBL: ENSMUSP00000033950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033950]
AlphaFold Q99LZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000033950
AA Change: Y208C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: Y208C

DomainStartEndE-ValueType
Pfam:Sld5 20 127 5.3e-9 PFAM
Pfam:SLD5_C 165 223 4.1e-21 PFAM
Meta Mutation Damage Score 0.9600 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,853,909 (GRCm39) I249M possibly damaging Het
Abl1 G T 2: 31,691,822 (GRCm39) A1114S probably damaging Het
Acbd5 T C 2: 22,989,733 (GRCm39) V452A probably damaging Het
Armc12 A G 17: 28,756,910 (GRCm39) D225G probably damaging Het
Atad3a T A 4: 155,840,139 (GRCm39) Q121H probably damaging Het
Atosa A T 9: 74,913,603 (GRCm39) T79S probably benign Het
Bptf T A 11: 106,963,873 (GRCm39) I1711F probably damaging Het
C2cd4c A T 10: 79,448,064 (GRCm39) I361N probably damaging Het
Canx A G 11: 50,199,221 (GRCm39) probably benign Het
Ccdc127 C T 13: 74,505,034 (GRCm39) T194I probably benign Het
Cdc42ep3 T C 17: 79,642,465 (GRCm39) K152E probably benign Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Cnbd2 T C 2: 156,181,204 (GRCm39) probably null Het
Cplane1 T A 15: 8,248,853 (GRCm39) Y1801N possibly damaging Het
Crybg1 T C 10: 43,851,074 (GRCm39) N1599S probably benign Het
Cyc1 T C 15: 76,228,548 (GRCm39) V59A probably benign Het
Cyp2j11 T C 4: 96,183,117 (GRCm39) K484E probably benign Het
Ddx60 T C 8: 62,411,193 (GRCm39) probably benign Het
Epg5 T C 18: 78,005,642 (GRCm39) S711P probably damaging Het
Espl1 A T 15: 102,214,120 (GRCm39) Q649L probably benign Het
Eya1 G A 1: 14,374,638 (GRCm39) probably benign Het
Fat2 T A 11: 55,186,913 (GRCm39) Y1311F probably damaging Het
Garin5b T A 7: 4,760,687 (GRCm39) H675L possibly damaging Het
Gsk3b T C 16: 37,910,937 (GRCm39) V17A probably benign Het
Gykl1 A T 18: 52,827,833 (GRCm39) K347I probably benign Het
Helz T A 11: 107,483,666 (GRCm39) probably benign Het
Hivep3 C T 4: 119,953,772 (GRCm39) T696I possibly damaging Het
Ifi27l2a G T 12: 103,409,093 (GRCm39) probably benign Het
Kif13a A G 13: 46,944,987 (GRCm39) probably benign Het
Kpna3 C T 14: 61,620,669 (GRCm39) probably benign Het
Mmp15 C G 8: 96,096,190 (GRCm39) P327R probably benign Het
Mrc1 A T 2: 14,320,074 (GRCm39) T1003S probably benign Het
Mtss1 T C 15: 58,819,239 (GRCm39) D393G probably benign Het
Olfm4 T A 14: 80,258,843 (GRCm39) Y331N probably damaging Het
Or10a49 T A 7: 108,468,167 (GRCm39) N65Y probably damaging Het
Or4c12b G C 2: 89,646,725 (GRCm39) L12F probably damaging Het
P2rx3 G C 2: 84,855,294 (GRCm39) T54R possibly damaging Het
Pacsin1 C T 17: 27,924,937 (GRCm39) T217I probably damaging Het
Phlpp1 A G 1: 106,308,155 (GRCm39) probably null Het
Pknox1 T C 17: 31,811,066 (GRCm39) probably benign Het
Plb1 A G 5: 32,422,256 (GRCm39) R70G possibly damaging Het
Rab3gap2 G A 1: 184,980,101 (GRCm39) A340T probably damaging Het
Rnf103 T A 6: 71,485,983 (GRCm39) W205R probably damaging Het
Rps6kc1 G A 1: 190,530,923 (GRCm39) T936M probably damaging Het
Spef2 T C 15: 9,596,793 (GRCm39) probably benign Het
Sstr4 A G 2: 148,238,279 (GRCm39) S297G probably benign Het
Timm8a1 C T X: 133,438,872 (GRCm39) E93K probably benign Het
Uck1 A C 2: 32,148,367 (GRCm39) Y150D probably damaging Het
Yipf4 A G 17: 74,805,300 (GRCm39) probably benign Het
Other mutations in Gins4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Gins4 APN 8 23,717,343 (GRCm39) missense probably benign 0.38
IGL01824:Gins4 APN 8 23,724,784 (GRCm39) nonsense probably null
IGL02304:Gins4 APN 8 23,722,625 (GRCm39) missense probably benign
IGL03194:Gins4 APN 8 23,724,762 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0267:Gins4 UTSW 8 23,719,426 (GRCm39) splice site probably benign
R1519:Gins4 UTSW 8 23,724,792 (GRCm39) missense probably benign 0.04
R4691:Gins4 UTSW 8 23,727,075 (GRCm39) missense probably benign 0.40
R4933:Gins4 UTSW 8 23,724,796 (GRCm39) missense probably damaging 0.99
R5088:Gins4 UTSW 8 23,727,084 (GRCm39) missense possibly damaging 0.87
R8098:Gins4 UTSW 8 23,727,037 (GRCm39) missense probably benign
R9679:Gins4 UTSW 8 23,717,132 (GRCm39) missense probably damaging 1.00
RF006:Gins4 UTSW 8 23,717,183 (GRCm39) missense possibly damaging 0.71
RF016:Gins4 UTSW 8 23,722,626 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCCACACATTGCTGACGAAC -3'
(R):5'- ACATCAGGAGCCTCCAGAGCATTG -3'

Sequencing Primer
(F):5'- CACACATTGCTGACGAACTGTATG -3'
(R):5'- GCTTTAGTCAAGTCGAACATGCC -3'
Posted On 2014-03-14