Incidental Mutation 'R1428:Gins4'
ID 161394
Institutional Source Beutler Lab
Gene Symbol Gins4
Ensembl Gene ENSMUSG00000031546
Gene Name GINS complex subunit 4 (Sld5 homolog)
Synonyms 2810037C03Rik, SLD5, 4933405K01Rik
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1428 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 23226616-23237659 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23227128 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 208 (Y208C)
Ref Sequence ENSEMBL: ENSMUSP00000033950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033950]
AlphaFold Q99LZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000033950
AA Change: Y208C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: Y208C

DomainStartEndE-ValueType
Pfam:Sld5 20 127 5.3e-9 PFAM
Pfam:SLD5_C 165 223 4.1e-21 PFAM
Meta Mutation Damage Score 0.9600 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Gins4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Gins4 APN 8 23227327 missense probably benign 0.38
IGL01824:Gins4 APN 8 23234768 nonsense probably null
IGL02304:Gins4 APN 8 23232609 missense probably benign
IGL03194:Gins4 APN 8 23234746 splice site probably benign
R0058:Gins4 UTSW 8 23229510 splice site probably benign
R0058:Gins4 UTSW 8 23229510 splice site probably benign
R0267:Gins4 UTSW 8 23229410 splice site probably benign
R1519:Gins4 UTSW 8 23234776 missense probably benign 0.04
R4691:Gins4 UTSW 8 23237059 missense probably benign 0.40
R4933:Gins4 UTSW 8 23234780 missense probably damaging 0.99
R5088:Gins4 UTSW 8 23237068 missense possibly damaging 0.87
R8098:Gins4 UTSW 8 23237021 missense probably benign
R9679:Gins4 UTSW 8 23227116 missense probably damaging 1.00
RF006:Gins4 UTSW 8 23227167 missense possibly damaging 0.71
RF016:Gins4 UTSW 8 23232610 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCCACACATTGCTGACGAAC -3'
(R):5'- ACATCAGGAGCCTCCAGAGCATTG -3'

Sequencing Primer
(F):5'- CACACATTGCTGACGAACTGTATG -3'
(R):5'- GCTTTAGTCAAGTCGAACATGCC -3'
Posted On 2014-03-14