Mutagenetix > Incidental Mutations

Incidental Mutation 'R1428:Gins4'

161394

Institutional Source

Beutler Lab

Gene Symbol

Gins4

Ensembl Gene

ENSMUSG00000031546

Gene Name

GINS complex subunit 4 (Sld5 homolog)

Synonyms

2810037C03Rik, SLD5, 4933405K01Rik

MMRRC Submission

039484-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23226616-23237659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23227128 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 208 (Y208C)

Ref Sequence

ENSEMBL: ENSMUSP00000033950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033950]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033950
AA Change: Y208C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: Y208C

Domain	Start	End	E-Value	Type
Pfam:Sld5	20	127	5.3e-9	PFAM
Pfam:SLD5_C	165	223	4.1e-21	PFAM

Meta Mutation Damage Score

0.9600

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2410089E03Rik	T	A	15: 8,219,369	Y1801N	possibly damaging	Het
Abl1	G	T	2: 31,801,810	A1114S	probably damaging	Het
Acbd5	T	C	2: 23,099,721	V452A	probably damaging	Het
Armc12	A	G	17: 28,537,936	D225G	probably damaging	Het
Atad3a	T	A	4: 155,755,682	Q121H	probably damaging	Het
Bptf	T	A	11: 107,073,047	I1711F	probably damaging	Het
C2cd4c	A	T	10: 79,612,230	I361N	probably damaging	Het
Canx	A	G	11: 50,308,394		probably benign	Het
Ccdc127	C	T	13: 74,356,915	T194I	probably benign	Het
Cdc42ep3	T	C	17: 79,335,036	K152E	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cnbd2	T	C	2: 156,339,284		probably null	Het
Crybg1	T	C	10: 43,975,078	N1599S	probably benign	Het
Cyc1	T	C	15: 76,344,348	V59A	probably benign	Het
Cyp2j11	T	C	4: 96,294,880	K484E	probably benign	Het
Ddx60	T	C	8: 61,958,159		probably benign	Het
Epg5	T	C	18: 77,962,427	S711P	probably damaging	Het
Espl1	A	T	15: 102,305,685	Q649L	probably benign	Het
Eya1	G	A	1: 14,304,414		probably benign	Het
Fam214a	A	T	9: 75,006,321	T79S	probably benign	Het
Fam71e2	T	A	7: 4,757,688	H675L	possibly damaging	Het
Fat2	T	A	11: 55,296,087	Y1311F	probably damaging	Het
Gsk3b	T	C	16: 38,090,575	V17A	probably benign	Het
Gykl1	A	T	18: 52,694,761	K347I	probably benign	Het
Helz	T	A	11: 107,592,840		probably benign	Het
Hivep3	C	T	4: 120,096,575	T696I	possibly damaging	Het
Ifi27l2a	G	T	12: 103,442,834		probably benign	Het
Kif13a	A	G	13: 46,791,511		probably benign	Het
Kpna3	C	T	14: 61,383,220		probably benign	Het
Mmp15	C	G	8: 95,369,562	P327R	probably benign	Het
Mrc1	A	T	2: 14,315,263	T1003S	probably benign	Het
Mtss1	T	C	15: 58,947,390	D393G	probably benign	Het
Olfm4	T	A	14: 80,021,403	Y331N	probably damaging	Het
Olfr1255	G	C	2: 89,816,381	L12F	probably damaging	Het
Olfr517	T	A	7: 108,868,960	N65Y	probably damaging	Het
P2rx3	G	C	2: 85,024,950	T54R	possibly damaging	Het
Pacsin1	C	T	17: 27,705,963	T217I	probably damaging	Het
Phlpp1	A	G	1: 106,380,425		probably null	Het
Pknox1	T	C	17: 31,592,092		probably benign	Het
Plb1	A	G	5: 32,264,912	R70G	possibly damaging	Het
Rab3gap2	G	A	1: 185,247,904	A340T	probably damaging	Het
Rnf103	T	A	6: 71,508,999	W205R	probably damaging	Het
Rps6kc1	G	A	1: 190,798,726	T936M	probably damaging	Het
Spef2	T	C	15: 9,596,707		probably benign	Het
Sstr4	A	G	2: 148,396,359	S297G	probably benign	Het
Timm8a1	C	T	X: 134,538,123	E93K	probably benign	Het
Uck1	A	C	2: 32,258,355	Y150D	probably damaging	Het
Yipf4	A	G	17: 74,498,305		probably benign	Het

Other mutations in Gins4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01376:Gins4	APN	8	23227327	missense	probably benign	0.38
IGL01824:Gins4	APN	8	23234768	nonsense	probably null
IGL02304:Gins4	APN	8	23232609	missense	probably benign
IGL03194:Gins4	APN	8	23234746	splice site	probably benign
R0058:Gins4	UTSW	8	23229510	splice site	probably benign
R0058:Gins4	UTSW	8	23229510	splice site	probably benign
R0267:Gins4	UTSW	8	23229410	splice site	probably benign
R1519:Gins4	UTSW	8	23234776	missense	probably benign	0.04
R4691:Gins4	UTSW	8	23237059	missense	probably benign	0.40
R4933:Gins4	UTSW	8	23234780	missense	probably damaging	0.99
R5088:Gins4	UTSW	8	23237068	missense	possibly damaging	0.87
RF006:Gins4	UTSW	8	23227167	missense	possibly damaging	0.71
RF016:Gins4	UTSW	8	23232610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTCCACACATTGCTGACGAAC -3'
(R):5'- ACATCAGGAGCCTCCAGAGCATTG -3'

Sequencing Primer
(F):5'- CACACATTGCTGACGAACTGTATG -3'
(R):5'- GCTTTAGTCAAGTCGAACATGCC -3'

Posted On

2014-03-14