Incidental Mutation 'R1428:Ddx60'
ID161395
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 61958159 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]
Predicted Effect probably benign
Transcript: ENSMUST00000070631
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154398
SMART Domains Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 unclassified probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7987:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTGTGTATGTGACCTCTCAAATTGCT -3'
(R):5'- GGACCTCCTCATGTCTTCAACACTCAAA -3'

Sequencing Primer
(F):5'- TGTTCCAAAAGACTCAATGTGG -3'
(R):5'- GTCTTCAACACTCAAACATTGCTTG -3'
Posted On2014-03-14