Mutagenetix > Incidental Mutation

Incidental Mutation 'R1428:Cdh15'

161397

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

039484-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1428 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 122857495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 112 (E112Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: E112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: E112Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.5702

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2410089E03Rik	T	A	15: 8,219,369	Y1801N	possibly damaging	Het
Abl1	G	T	2: 31,801,810	A1114S	probably damaging	Het
Acbd5	T	C	2: 23,099,721	V452A	probably damaging	Het
Armc12	A	G	17: 28,537,936	D225G	probably damaging	Het
Atad3a	T	A	4: 155,755,682	Q121H	probably damaging	Het
Bptf	T	A	11: 107,073,047	I1711F	probably damaging	Het
C2cd4c	A	T	10: 79,612,230	I361N	probably damaging	Het
Canx	A	G	11: 50,308,394		probably benign	Het
Ccdc127	C	T	13: 74,356,915	T194I	probably benign	Het
Cdc42ep3	T	C	17: 79,335,036	K152E	probably benign	Het
Cnbd2	T	C	2: 156,339,284		probably null	Het
Crybg1	T	C	10: 43,975,078	N1599S	probably benign	Het
Cyc1	T	C	15: 76,344,348	V59A	probably benign	Het
Cyp2j11	T	C	4: 96,294,880	K484E	probably benign	Het
Ddx60	T	C	8: 61,958,159		probably benign	Het
Epg5	T	C	18: 77,962,427	S711P	probably damaging	Het
Espl1	A	T	15: 102,305,685	Q649L	probably benign	Het
Eya1	G	A	1: 14,304,414		probably benign	Het
Fam214a	A	T	9: 75,006,321	T79S	probably benign	Het
Fam71e2	T	A	7: 4,757,688	H675L	possibly damaging	Het
Fat2	T	A	11: 55,296,087	Y1311F	probably damaging	Het
Gins4	T	C	8: 23,227,128	Y208C	probably damaging	Het
Gsk3b	T	C	16: 38,090,575	V17A	probably benign	Het
Gykl1	A	T	18: 52,694,761	K347I	probably benign	Het
Helz	T	A	11: 107,592,840		probably benign	Het
Hivep3	C	T	4: 120,096,575	T696I	possibly damaging	Het
Ifi27l2a	G	T	12: 103,442,834		probably benign	Het
Kif13a	A	G	13: 46,791,511		probably benign	Het
Kpna3	C	T	14: 61,383,220		probably benign	Het
Mmp15	C	G	8: 95,369,562	P327R	probably benign	Het
Mrc1	A	T	2: 14,315,263	T1003S	probably benign	Het
Mtss1	T	C	15: 58,947,390	D393G	probably benign	Het
Olfm4	T	A	14: 80,021,403	Y331N	probably damaging	Het
Olfr1255	G	C	2: 89,816,381	L12F	probably damaging	Het
Olfr517	T	A	7: 108,868,960	N65Y	probably damaging	Het
P2rx3	G	C	2: 85,024,950	T54R	possibly damaging	Het
Pacsin1	C	T	17: 27,705,963	T217I	probably damaging	Het
Phlpp1	A	G	1: 106,380,425		probably null	Het
Pknox1	T	C	17: 31,592,092		probably benign	Het
Plb1	A	G	5: 32,264,912	R70G	possibly damaging	Het
Rab3gap2	G	A	1: 185,247,904	A340T	probably damaging	Het
Rnf103	T	A	6: 71,508,999	W205R	probably damaging	Het
Rps6kc1	G	A	1: 190,798,726	T936M	probably damaging	Het
Spef2	T	C	15: 9,596,707		probably benign	Het
Sstr4	A	G	2: 148,396,359	S297G	probably benign	Het
Timm8a1	C	T	X: 134,538,123	E93K	probably benign	Het
Uck1	A	C	2: 32,258,355	Y150D	probably damaging	Het
Yipf4	A	G	17: 74,498,305		probably benign	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	122860889	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	122848501	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	122857517	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	122859290	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	122862030	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	122864285	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTGTTGGGGTGAAACACGAAG -3'
(R):5'- ACAGTGATGCTCTGCTCTCCAAAAG -3'

Sequencing Primer
(F):5'- CACGAAGGTATTGGGGTGC -3'
(R):5'- ACCTATTCGCGGCCTCAAG -3'

Posted On

2014-03-14