Mutagenetix > Incidental Mutation

Incidental Mutation 'R1428:Canx'

161401

Institutional Source

Beutler Lab

Gene Symbol

Canx

Ensembl Gene

ENSMUSG00000020368

Gene Name

calnexin

Synonyms

1110069N15Rik, CNX

MMRRC Submission

039484-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R1428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50293961-50325673 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 50308394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]

AlphaFold

P35564

Predicted Effect

probably benign
Transcript: ENSMUST00000020637

SMART Domains

Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	72	441	1.7e-170	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179865

SMART Domains

Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	70	441	4.7e-166	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2410089E03Rik	T	A	15: 8,219,369	Y1801N	possibly damaging	Het
Abl1	G	T	2: 31,801,810	A1114S	probably damaging	Het
Acbd5	T	C	2: 23,099,721	V452A	probably damaging	Het
Armc12	A	G	17: 28,537,936	D225G	probably damaging	Het
Atad3a	T	A	4: 155,755,682	Q121H	probably damaging	Het
Bptf	T	A	11: 107,073,047	I1711F	probably damaging	Het
C2cd4c	A	T	10: 79,612,230	I361N	probably damaging	Het
Ccdc127	C	T	13: 74,356,915	T194I	probably benign	Het
Cdc42ep3	T	C	17: 79,335,036	K152E	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cnbd2	T	C	2: 156,339,284		probably null	Het
Crybg1	T	C	10: 43,975,078	N1599S	probably benign	Het
Cyc1	T	C	15: 76,344,348	V59A	probably benign	Het
Cyp2j11	T	C	4: 96,294,880	K484E	probably benign	Het
Ddx60	T	C	8: 61,958,159		probably benign	Het
Epg5	T	C	18: 77,962,427	S711P	probably damaging	Het
Espl1	A	T	15: 102,305,685	Q649L	probably benign	Het
Eya1	G	A	1: 14,304,414		probably benign	Het
Fam214a	A	T	9: 75,006,321	T79S	probably benign	Het
Fam71e2	T	A	7: 4,757,688	H675L	possibly damaging	Het
Fat2	T	A	11: 55,296,087	Y1311F	probably damaging	Het
Gins4	T	C	8: 23,227,128	Y208C	probably damaging	Het
Gsk3b	T	C	16: 38,090,575	V17A	probably benign	Het
Gykl1	A	T	18: 52,694,761	K347I	probably benign	Het
Helz	T	A	11: 107,592,840		probably benign	Het
Hivep3	C	T	4: 120,096,575	T696I	possibly damaging	Het
Ifi27l2a	G	T	12: 103,442,834		probably benign	Het
Kif13a	A	G	13: 46,791,511		probably benign	Het
Kpna3	C	T	14: 61,383,220		probably benign	Het
Mmp15	C	G	8: 95,369,562	P327R	probably benign	Het
Mrc1	A	T	2: 14,315,263	T1003S	probably benign	Het
Mtss1	T	C	15: 58,947,390	D393G	probably benign	Het
Olfm4	T	A	14: 80,021,403	Y331N	probably damaging	Het
Olfr1255	G	C	2: 89,816,381	L12F	probably damaging	Het
Olfr517	T	A	7: 108,868,960	N65Y	probably damaging	Het
P2rx3	G	C	2: 85,024,950	T54R	possibly damaging	Het
Pacsin1	C	T	17: 27,705,963	T217I	probably damaging	Het
Phlpp1	A	G	1: 106,380,425		probably null	Het
Pknox1	T	C	17: 31,592,092		probably benign	Het
Plb1	A	G	5: 32,264,912	R70G	possibly damaging	Het
Rab3gap2	G	A	1: 185,247,904	A340T	probably damaging	Het
Rnf103	T	A	6: 71,508,999	W205R	probably damaging	Het
Rps6kc1	G	A	1: 190,798,726	T936M	probably damaging	Het
Spef2	T	C	15: 9,596,707		probably benign	Het
Sstr4	A	G	2: 148,396,359	S297G	probably benign	Het
Timm8a1	C	T	X: 134,538,123	E93K	probably benign	Het
Uck1	A	C	2: 32,258,355	Y150D	probably damaging	Het
Yipf4	A	G	17: 74,498,305		probably benign	Het

Other mutations in Canx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Canx	APN	11	50300996	missense	possibly damaging	0.61
IGL03089:Canx	APN	11	50304482	missense	possibly damaging	0.85
R1876:Canx	UTSW	11	50304359	missense	probably damaging	1.00
R2057:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2058:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2088:Canx	UTSW	11	50310390	missense	possibly damaging	0.89
R2126:Canx	UTSW	11	50304358	missense	probably damaging	1.00
R2217:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2218:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2386:Canx	UTSW	11	50297106	missense	probably benign
R3716:Canx	UTSW	11	50304474	missense	probably benign	0.14
R3957:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R4019:Canx	UTSW	11	50299245	missense	probably damaging	1.00
R4402:Canx	UTSW	11	50304438	missense	probably benign	0.13
R4825:Canx	UTSW	11	50308809	missense	probably benign	0.42
R5252:Canx	UTSW	11	50308794	missense	probably damaging	1.00
R5385:Canx	UTSW	11	50301812	missense	probably damaging	1.00
R5797:Canx	UTSW	11	50301017	missense	probably benign	0.00
R5820:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R6052:Canx	UTSW	11	50297119	missense	possibly damaging	0.49
R7259:Canx	UTSW	11	50301816	missense	probably damaging	1.00
R7603:Canx	UTSW	11	50311628	missense	probably benign
R7715:Canx	UTSW	11	50310804	missense	probably benign	0.13
R7735:Canx	UTSW	11	50301039	missense	probably damaging	0.97
R8063:Canx	UTSW	11	50308346	nonsense	probably null
R8069:Canx	UTSW	11	50311704	missense	possibly damaging	0.93
R8494:Canx	UTSW	11	50311782	critical splice acceptor site	probably null
R8508:Canx	UTSW	11	50311647	missense	possibly damaging	0.85
R8941:Canx	UTSW	11	50304443	missense	possibly damaging	0.90
R9153:Canx	UTSW	11	50297335	missense	probably benign
R9722:Canx	UTSW	11	50304474	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GGTTCACCAGCAGCAGCATTTC -3'
(R):5'- TTGTACTGATGTCTCGGGCCAAGC -3'

Sequencing Primer
(F):5'- ttttctctctttaaatgatggggac -3'
(R):5'- GTTCAGTAAGTTCAGTGCCATC -3'

Posted On

2014-03-14