Incidental Mutation 'R1428:Canx'
ID 161401
Institutional Source Beutler Lab
Gene Symbol Canx
Ensembl Gene ENSMUSG00000020368
Gene Name calnexin
Synonyms 1110069N15Rik, CNX
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock # R1428 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 50293961-50325673 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 50308394 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]
AlphaFold P35564
Predicted Effect probably benign
Transcript: ENSMUST00000020637
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368

signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179865
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368

signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Canx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Canx APN 11 50300996 missense possibly damaging 0.61
IGL03089:Canx APN 11 50304482 missense possibly damaging 0.85
R1876:Canx UTSW 11 50304359 missense probably damaging 1.00
R2057:Canx UTSW 11 50304425 missense probably damaging 0.97
R2058:Canx UTSW 11 50304425 missense probably damaging 0.97
R2088:Canx UTSW 11 50310390 missense possibly damaging 0.89
R2126:Canx UTSW 11 50304358 missense probably damaging 1.00
R2217:Canx UTSW 11 50310867 missense probably benign 0.24
R2218:Canx UTSW 11 50310867 missense probably benign 0.24
R2386:Canx UTSW 11 50297106 missense probably benign
R3716:Canx UTSW 11 50304474 missense probably benign 0.14
R3957:Canx UTSW 11 50308383 missense probably damaging 1.00
R4019:Canx UTSW 11 50299245 missense probably damaging 1.00
R4402:Canx UTSW 11 50304438 missense probably benign 0.13
R4825:Canx UTSW 11 50308809 missense probably benign 0.42
R5252:Canx UTSW 11 50308794 missense probably damaging 1.00
R5385:Canx UTSW 11 50301812 missense probably damaging 1.00
R5797:Canx UTSW 11 50301017 missense probably benign 0.00
R5820:Canx UTSW 11 50308383 missense probably damaging 1.00
R6052:Canx UTSW 11 50297119 missense possibly damaging 0.49
R7259:Canx UTSW 11 50301816 missense probably damaging 1.00
R7603:Canx UTSW 11 50311628 missense probably benign
R7715:Canx UTSW 11 50310804 missense probably benign 0.13
R7735:Canx UTSW 11 50301039 missense probably damaging 0.97
R8063:Canx UTSW 11 50308346 nonsense probably null
R8069:Canx UTSW 11 50311704 missense possibly damaging 0.93
R8494:Canx UTSW 11 50311782 critical splice acceptor site probably null
R8508:Canx UTSW 11 50311647 missense possibly damaging 0.85
R8941:Canx UTSW 11 50304443 missense possibly damaging 0.90
R9153:Canx UTSW 11 50297335 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttttctctctttaaatgatggggac -3'
Posted On 2014-03-14