Mutagenetix > Incidental Mutation

Incidental Mutation 'R1428:Spef2'

161411

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

039484-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R1428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 9596707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]

AlphaFold

Q8C9J3

Predicted Effect

probably benign
Transcript: ENSMUST00000159288

SMART Domains

Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:CH_2	5	102	3.1e-25	PFAM
low complexity region	106	115	N/A	INTRINSIC
low complexity region	137	148	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	602	789	8.8e-11	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1221	N/A	INTRINSIC
low complexity region	1264	1278	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
SCOP:d1rec__	1378	1530	3e-3	SMART
low complexity region	1605	1624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160236

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208854

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.2%

Validation Efficiency

98% (56/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,411	I249M	possibly damaging	Het
2410089E03Rik	T	A	15: 8,219,369	Y1801N	possibly damaging	Het
Abl1	G	T	2: 31,801,810	A1114S	probably damaging	Het
Acbd5	T	C	2: 23,099,721	V452A	probably damaging	Het
Armc12	A	G	17: 28,537,936	D225G	probably damaging	Het
Atad3a	T	A	4: 155,755,682	Q121H	probably damaging	Het
Bptf	T	A	11: 107,073,047	I1711F	probably damaging	Het
C2cd4c	A	T	10: 79,612,230	I361N	probably damaging	Het
Canx	A	G	11: 50,308,394		probably benign	Het
Ccdc127	C	T	13: 74,356,915	T194I	probably benign	Het
Cdc42ep3	T	C	17: 79,335,036	K152E	probably benign	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cnbd2	T	C	2: 156,339,284		probably null	Het
Crybg1	T	C	10: 43,975,078	N1599S	probably benign	Het
Cyc1	T	C	15: 76,344,348	V59A	probably benign	Het
Cyp2j11	T	C	4: 96,294,880	K484E	probably benign	Het
Ddx60	T	C	8: 61,958,159		probably benign	Het
Epg5	T	C	18: 77,962,427	S711P	probably damaging	Het
Espl1	A	T	15: 102,305,685	Q649L	probably benign	Het
Eya1	G	A	1: 14,304,414		probably benign	Het
Fam214a	A	T	9: 75,006,321	T79S	probably benign	Het
Fam71e2	T	A	7: 4,757,688	H675L	possibly damaging	Het
Fat2	T	A	11: 55,296,087	Y1311F	probably damaging	Het
Gins4	T	C	8: 23,227,128	Y208C	probably damaging	Het
Gsk3b	T	C	16: 38,090,575	V17A	probably benign	Het
Gykl1	A	T	18: 52,694,761	K347I	probably benign	Het
Helz	T	A	11: 107,592,840		probably benign	Het
Hivep3	C	T	4: 120,096,575	T696I	possibly damaging	Het
Ifi27l2a	G	T	12: 103,442,834		probably benign	Het
Kif13a	A	G	13: 46,791,511		probably benign	Het
Kpna3	C	T	14: 61,383,220		probably benign	Het
Mmp15	C	G	8: 95,369,562	P327R	probably benign	Het
Mrc1	A	T	2: 14,315,263	T1003S	probably benign	Het
Mtss1	T	C	15: 58,947,390	D393G	probably benign	Het
Olfm4	T	A	14: 80,021,403	Y331N	probably damaging	Het
Olfr1255	G	C	2: 89,816,381	L12F	probably damaging	Het
Olfr517	T	A	7: 108,868,960	N65Y	probably damaging	Het
P2rx3	G	C	2: 85,024,950	T54R	possibly damaging	Het
Pacsin1	C	T	17: 27,705,963	T217I	probably damaging	Het
Phlpp1	A	G	1: 106,380,425		probably null	Het
Pknox1	T	C	17: 31,592,092		probably benign	Het
Plb1	A	G	5: 32,264,912	R70G	possibly damaging	Het
Rab3gap2	G	A	1: 185,247,904	A340T	probably damaging	Het
Rnf103	T	A	6: 71,508,999	W205R	probably damaging	Het
Rps6kc1	G	A	1: 190,798,726	T936M	probably damaging	Het
Sstr4	A	G	2: 148,396,359	S297G	probably benign	Het
Timm8a1	C	T	X: 134,538,123	E93K	probably benign	Het
Uck1	A	C	2: 32,258,355	Y150D	probably damaging	Het
Yipf4	A	G	17: 74,498,305		probably benign	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	splice site	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9601085	missense	unknown
R8105:Spef2	UTSW	15	9682662	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9601512	missense	unknown
R8296:Spef2	UTSW	15	9727543	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9676529	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9612557	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9600679	intron	probably benign
R8691:Spef2	UTSW	15	9601919	nonsense	probably null
R8751:Spef2	UTSW	15	9729637	nonsense	probably null
R8847:Spef2	UTSW	15	9668827	missense	probably benign
R8864:Spef2	UTSW	15	9599747	missense	unknown
R8868:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R8916:Spef2	UTSW	15	9725180	nonsense	probably null
R8935:Spef2	UTSW	15	9607350	missense	probably damaging	0.98
R8961:Spef2	UTSW	15	9647328	missense	possibly damaging	0.92
R8978:Spef2	UTSW	15	9725177	missense	possibly damaging	0.81
R9062:Spef2	UTSW	15	9601631	missense	unknown
R9076:Spef2	UTSW	15	9653005	missense	probably benign	0.13
R9149:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R9162:Spef2	UTSW	15	9601931	missense	unknown
R9216:Spef2	UTSW	15	9647525	missense	probably damaging	1.00
R9240:Spef2	UTSW	15	9578315	nonsense	probably null
R9278:Spef2	UTSW	15	9727409	critical splice donor site	probably null
R9341:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9343:Spef2	UTSW	15	9713104	missense	probably damaging	1.00
R9389:Spef2	UTSW	15	9725221	missense	probably damaging	0.96
R9476:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9510:Spef2	UTSW	15	9713117	missense	probably damaging	1.00
R9537:Spef2	UTSW	15	9601799	missense	unknown
R9575:Spef2	UTSW	15	9596586	missense	probably damaging	1.00
R9597:Spef2	UTSW	15	9599811	missense	unknown
R9765:Spef2	UTSW	15	9601859	missense	unknown
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGGCAGTGGATCATTTAAAGCCC -3'
(R):5'- AAACAGTTGCCTGGTGTGGCTC -3'

Sequencing Primer
(F):5'- agccacaggAATAATTACTAGCTGAG -3'
(R):5'- GTGGCTCCGTTGTTAGAATAGAAAAC -3'

Posted On

2014-03-14