Incidental Mutation 'R1428:Mtss1'
ID161412
Institutional Source Beutler Lab
Gene Symbol Mtss1
Ensembl Gene ENSMUSG00000022353
Gene Namemetastasis suppressor 1
SynonymsD130001D01Rik, 2310003N14Rik, MIM
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R1428 (G1)
Quality Score201
Status Validated
Chromosome15
Chromosomal Location58941234-59082005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58947390 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 393 (D393G)
Ref Sequence ENSEMBL: ENSMUSP00000079239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080371]
Predicted Effect probably benign
Transcript: ENSMUST00000080371
AA Change: D393G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079239
Gene: ENSMUSG00000022353
AA Change: D393G

DomainStartEndE-ValueType
Pfam:IMD 16 241 2.1e-107 PFAM
low complexity region 257 309 N/A INTRINSIC
low complexity region 443 459 N/A INTRINSIC
low complexity region 612 628 N/A INTRINSIC
WH2 731 748 1.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226976
Predicted Effect probably benign
Transcript: ENSMUST00000227045
Predicted Effect unknown
Transcript: ENSMUST00000227196
AA Change: D176G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227290
Predicted Effect probably benign
Transcript: ENSMUST00000228067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228365
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit polycystic kidney in 50% of mice by 5 months of age. Mouse embryonic fibroblasts from mice homozygous for a different gene trap allele exhibit altered cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Mtss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Mtss1 APN 15 58951468 critical splice donor site probably null
IGL00693:Mtss1 APN 15 58944124 missense probably damaging 1.00
IGL00817:Mtss1 APN 15 58943632 unclassified probably null
IGL00923:Mtss1 APN 15 58943499 missense possibly damaging 0.80
IGL01704:Mtss1 APN 15 59055083 missense possibly damaging 0.91
IGL02257:Mtss1 APN 15 58956545 missense probably damaging 1.00
IGL02632:Mtss1 APN 15 58944015 missense probably damaging 0.99
IGL02829:Mtss1 APN 15 59058428 splice site probably benign
IGL02838:Mtss1 APN 15 59081515 missense probably benign 0.06
IGL02968:Mtss1 APN 15 58956515 missense possibly damaging 0.77
IGL03012:Mtss1 APN 15 59058400 missense probably damaging 0.97
IGL03022:Mtss1 APN 15 58953590 missense probably damaging 1.00
R0193:Mtss1 UTSW 15 58944017 missense probably damaging 0.99
R0498:Mtss1 UTSW 15 58945437 missense probably damaging 1.00
R0510:Mtss1 UTSW 15 58956538 missense probably benign 0.07
R0655:Mtss1 UTSW 15 59081502 missense probably damaging 0.99
R1183:Mtss1 UTSW 15 58971048 missense probably damaging 0.97
R1503:Mtss1 UTSW 15 58951672 missense probably damaging 1.00
R1597:Mtss1 UTSW 15 58943711 missense probably damaging 1.00
R1795:Mtss1 UTSW 15 59058400 missense possibly damaging 0.92
R3689:Mtss1 UTSW 15 58953536 missense probably damaging 1.00
R4724:Mtss1 UTSW 15 59081518 missense probably damaging 0.98
R4811:Mtss1 UTSW 15 58944073 missense probably damaging 1.00
R4968:Mtss1 UTSW 15 58943918 missense probably damaging 1.00
R5082:Mtss1 UTSW 15 58971019 missense probably damaging 1.00
R5783:Mtss1 UTSW 15 58943524 missense probably benign 0.05
R6253:Mtss1 UTSW 15 58943719 missense probably benign 0.02
R6767:Mtss1 UTSW 15 58953581 missense probably benign 0.00
R6890:Mtss1 UTSW 15 58951659 missense probably damaging 1.00
R7001:Mtss1 UTSW 15 58948334 intron probably benign
R7502:Mtss1 UTSW 15 58948361 missense probably damaging 0.96
R7722:Mtss1 UTSW 15 59055086 missense probably damaging 1.00
R7867:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7888:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
R7950:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7971:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
Z1177:Mtss1 UTSW 15 58945420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCTAGCAGTCCCTGATTTCC -3'
(R):5'- GGTGTCAGTGCCATCTTGGATCTC -3'

Sequencing Primer
(F):5'- gagggagggaggaaaggag -3'
(R):5'- AGTGCCATCTTGGATCTCTACAC -3'
Posted On2014-03-14