Incidental Mutation 'R1428:Pacsin1'
ID 161416
Institutional Source Beutler Lab
Gene Symbol Pacsin1
Ensembl Gene ENSMUSG00000040276
Gene Name protein kinase C and casein kinase substrate in neurons 1
Synonyms A830061D09Rik, Syndapin I
MMRRC Submission 039484-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R1428 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 27874565-27930092 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27924937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 217 (T217I)
Ref Sequence ENSEMBL: ENSMUSP00000155999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045896] [ENSMUST00000097360] [ENSMUST00000114872] [ENSMUST00000114873] [ENSMUST00000231236] [ENSMUST00000231669] [ENSMUST00000232437]
AlphaFold Q61644
Predicted Effect probably damaging
Transcript: ENSMUST00000045896
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044168
Gene: ENSMUSG00000040276
AA Change: T217I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097360
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094973
Gene: ENSMUSG00000040276
AA Change: T217I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114872
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110522
Gene: ENSMUSG00000040276
AA Change: T60I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114873
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110523
Gene: ENSMUSG00000040276
AA Change: T217I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231350
Predicted Effect probably damaging
Transcript: ENSMUST00000231669
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232437
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232225
Meta Mutation Damage Score 0.2171 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Homozygotes for a gene trapped allele show altered type I interferon responses in plasmacytoid dendritic cells. Homozygotes for a null allele show impaired synaptic vesicle formation, synaptic transmission and neuronal network activity, and develop generalized seizures with tonic-clonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,853,909 (GRCm39) I249M possibly damaging Het
Abl1 G T 2: 31,691,822 (GRCm39) A1114S probably damaging Het
Acbd5 T C 2: 22,989,733 (GRCm39) V452A probably damaging Het
Armc12 A G 17: 28,756,910 (GRCm39) D225G probably damaging Het
Atad3a T A 4: 155,840,139 (GRCm39) Q121H probably damaging Het
Atosa A T 9: 74,913,603 (GRCm39) T79S probably benign Het
Bptf T A 11: 106,963,873 (GRCm39) I1711F probably damaging Het
C2cd4c A T 10: 79,448,064 (GRCm39) I361N probably damaging Het
Canx A G 11: 50,199,221 (GRCm39) probably benign Het
Ccdc127 C T 13: 74,505,034 (GRCm39) T194I probably benign Het
Cdc42ep3 T C 17: 79,642,465 (GRCm39) K152E probably benign Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Cnbd2 T C 2: 156,181,204 (GRCm39) probably null Het
Cplane1 T A 15: 8,248,853 (GRCm39) Y1801N possibly damaging Het
Crybg1 T C 10: 43,851,074 (GRCm39) N1599S probably benign Het
Cyc1 T C 15: 76,228,548 (GRCm39) V59A probably benign Het
Cyp2j11 T C 4: 96,183,117 (GRCm39) K484E probably benign Het
Ddx60 T C 8: 62,411,193 (GRCm39) probably benign Het
Epg5 T C 18: 78,005,642 (GRCm39) S711P probably damaging Het
Espl1 A T 15: 102,214,120 (GRCm39) Q649L probably benign Het
Eya1 G A 1: 14,374,638 (GRCm39) probably benign Het
Fat2 T A 11: 55,186,913 (GRCm39) Y1311F probably damaging Het
Garin5b T A 7: 4,760,687 (GRCm39) H675L possibly damaging Het
Gins4 T C 8: 23,717,144 (GRCm39) Y208C probably damaging Het
Gsk3b T C 16: 37,910,937 (GRCm39) V17A probably benign Het
Gykl1 A T 18: 52,827,833 (GRCm39) K347I probably benign Het
Helz T A 11: 107,483,666 (GRCm39) probably benign Het
Hivep3 C T 4: 119,953,772 (GRCm39) T696I possibly damaging Het
Ifi27l2a G T 12: 103,409,093 (GRCm39) probably benign Het
Kif13a A G 13: 46,944,987 (GRCm39) probably benign Het
Kpna3 C T 14: 61,620,669 (GRCm39) probably benign Het
Mmp15 C G 8: 96,096,190 (GRCm39) P327R probably benign Het
Mrc1 A T 2: 14,320,074 (GRCm39) T1003S probably benign Het
Mtss1 T C 15: 58,819,239 (GRCm39) D393G probably benign Het
Olfm4 T A 14: 80,258,843 (GRCm39) Y331N probably damaging Het
Or10a49 T A 7: 108,468,167 (GRCm39) N65Y probably damaging Het
Or4c12b G C 2: 89,646,725 (GRCm39) L12F probably damaging Het
P2rx3 G C 2: 84,855,294 (GRCm39) T54R possibly damaging Het
Phlpp1 A G 1: 106,308,155 (GRCm39) probably null Het
Pknox1 T C 17: 31,811,066 (GRCm39) probably benign Het
Plb1 A G 5: 32,422,256 (GRCm39) R70G possibly damaging Het
Rab3gap2 G A 1: 184,980,101 (GRCm39) A340T probably damaging Het
Rnf103 T A 6: 71,485,983 (GRCm39) W205R probably damaging Het
Rps6kc1 G A 1: 190,530,923 (GRCm39) T936M probably damaging Het
Spef2 T C 15: 9,596,793 (GRCm39) probably benign Het
Sstr4 A G 2: 148,238,279 (GRCm39) S297G probably benign Het
Timm8a1 C T X: 133,438,872 (GRCm39) E93K probably benign Het
Uck1 A C 2: 32,148,367 (GRCm39) Y150D probably damaging Het
Yipf4 A G 17: 74,805,300 (GRCm39) probably benign Het
Other mutations in Pacsin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Pacsin1 APN 17 27,923,809 (GRCm39) splice site probably null
IGL02752:Pacsin1 APN 17 27,921,672 (GRCm39) critical splice acceptor site probably null
R2332:Pacsin1 UTSW 17 27,923,885 (GRCm39) missense possibly damaging 0.73
R4349:Pacsin1 UTSW 17 27,925,978 (GRCm39) missense possibly damaging 0.52
R4664:Pacsin1 UTSW 17 27,926,038 (GRCm39) missense probably damaging 1.00
R5568:Pacsin1 UTSW 17 27,927,022 (GRCm39) missense probably damaging 1.00
R5936:Pacsin1 UTSW 17 27,923,971 (GRCm39) missense probably benign 0.16
R5943:Pacsin1 UTSW 17 27,925,045 (GRCm39) missense probably damaging 1.00
R6277:Pacsin1 UTSW 17 27,924,969 (GRCm39) splice site probably null
R6284:Pacsin1 UTSW 17 27,927,478 (GRCm39) missense probably damaging 1.00
R6376:Pacsin1 UTSW 17 27,926,879 (GRCm39) missense probably benign 0.33
R7134:Pacsin1 UTSW 17 27,921,707 (GRCm39) missense probably damaging 1.00
R7972:Pacsin1 UTSW 17 27,927,613 (GRCm39) missense unknown
R8141:Pacsin1 UTSW 17 27,926,034 (GRCm39) missense possibly damaging 0.78
R9263:Pacsin1 UTSW 17 27,923,924 (GRCm39) missense probably damaging 1.00
R9316:Pacsin1 UTSW 17 27,924,707 (GRCm39) missense possibly damaging 0.77
R9414:Pacsin1 UTSW 17 27,926,985 (GRCm39) missense probably damaging 0.99
Z1177:Pacsin1 UTSW 17 27,927,412 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTAAGACAGAGCAGTCGGTCAC -3'
(R):5'- GCTGCATTTGCAGGCTCTTACCAG -3'

Sequencing Primer
(F):5'- GTACCTgtggtggtgcctg -3'
(R):5'- TCCCCGTGAGTCGTccc -3'
Posted On 2014-03-14