Incidental Mutation 'R1428:Pacsin1'
ID161416
Institutional Source Beutler Lab
Gene Symbol Pacsin1
Ensembl Gene ENSMUSG00000040276
Gene Nameprotein kinase C and casein kinase substrate in neurons 1
SynonymsA830061D09Rik, Syndapin I
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27655509-27711482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27705963 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 217 (T217I)
Ref Sequence ENSEMBL: ENSMUSP00000155999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045896] [ENSMUST00000097360] [ENSMUST00000114872] [ENSMUST00000114873] [ENSMUST00000231236] [ENSMUST00000231669] [ENSMUST00000232437]
Predicted Effect probably damaging
Transcript: ENSMUST00000045896
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044168
Gene: ENSMUSG00000040276
AA Change: T217I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097360
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094973
Gene: ENSMUSG00000040276
AA Change: T217I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114872
AA Change: T60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110522
Gene: ENSMUSG00000040276
AA Change: T60I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114873
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110523
Gene: ENSMUSG00000040276
AA Change: T217I

DomainStartEndE-ValueType
FCH 14 102 1.53e-29 SMART
low complexity region 144 156 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
SH3 385 441 8.11e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231350
Predicted Effect probably damaging
Transcript: ENSMUST00000231669
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232225
Predicted Effect probably damaging
Transcript: ENSMUST00000232437
AA Change: T217I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2171 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Homozygotes for a gene trapped allele show altered type I interferon responses in plasmacytoid dendritic cells. Homozygotes for a null allele show impaired synaptic vesicle formation, synaptic transmission and neuronal network activity, and develop generalized seizures with tonic-clonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Pacsin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Pacsin1 APN 17 27704835 splice site probably null
IGL02752:Pacsin1 APN 17 27702698 critical splice acceptor site probably null
R2332:Pacsin1 UTSW 17 27704911 missense possibly damaging 0.73
R4349:Pacsin1 UTSW 17 27707004 missense possibly damaging 0.52
R4664:Pacsin1 UTSW 17 27707064 missense probably damaging 1.00
R5568:Pacsin1 UTSW 17 27708048 missense probably damaging 1.00
R5936:Pacsin1 UTSW 17 27704997 missense probably benign 0.16
R5943:Pacsin1 UTSW 17 27706071 missense probably damaging 1.00
R6277:Pacsin1 UTSW 17 27705995 unclassified probably null
R6284:Pacsin1 UTSW 17 27708504 missense probably damaging 1.00
R6376:Pacsin1 UTSW 17 27707905 missense probably benign 0.33
R7134:Pacsin1 UTSW 17 27702733 missense probably damaging 1.00
Z1177:Pacsin1 UTSW 17 27708438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTAAGACAGAGCAGTCGGTCAC -3'
(R):5'- GCTGCATTTGCAGGCTCTTACCAG -3'

Sequencing Primer
(F):5'- GTACCTgtggtggtgcctg -3'
(R):5'- TCCCCGTGAGTCGTccc -3'
Posted On2014-03-14