Incidental Mutation 'R1428:Yipf4'
ID161419
Institutional Source Beutler Lab
Gene Symbol Yipf4
Ensembl Gene ENSMUSG00000024072
Gene NameYip1 domain family, member 4
Synonyms2310034L04Rik
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74489493-74500277 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 74498305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024873]
Predicted Effect probably benign
Transcript: ENSMUST00000024873
SMART Domains Protein: ENSMUSP00000024873
Gene: ENSMUSG00000024072

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Yip1 83 240 3.8e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Other mutations in Yipf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Yipf4 APN 17 74492388 missense possibly damaging 0.95
R1470:Yipf4 UTSW 17 74493968 missense probably benign 0.03
R1470:Yipf4 UTSW 17 74493968 missense probably benign 0.03
R3747:Yipf4 UTSW 17 74496672 splice site probably null
R4581:Yipf4 UTSW 17 74499094 missense probably benign 0.23
R4863:Yipf4 UTSW 17 74494092 missense probably damaging 0.99
R4871:Yipf4 UTSW 17 74494094 missense probably benign 0.04
R5185:Yipf4 UTSW 17 74492475 missense probably null 0.90
R7338:Yipf4 UTSW 17 74489776 missense probably benign 0.00
Z1176:Yipf4 UTSW 17 74498331 missense not run
Predicted Primers PCR Primer
(F):5'- CTAGAGACAAGGTTCGGCAGTGTG -3'
(R):5'- CGTGACCTGGTGCAAGTGAGAC -3'

Sequencing Primer
(F):5'- TTTGAATATCAGAACACTGGAGC -3'
(R):5'- TTCAAGGCAAGCCTGAGC -3'
Posted On2014-03-14