Incidental Mutation 'R1429:Arhgef4'
ID161425
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene NameRho guanine nucleotide exchange factor (GEF) 4
Synonyms9330140K16Rik, Asef
MMRRC Submission 039485-MU
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1429 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location34678188-34813309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34810339 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 481 (Y481C)
Ref Sequence ENSEMBL: ENSMUSP00000124906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599] [ENSMUST00000167518]
Predicted Effect probably benign
Transcript: ENSMUST00000047534
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047664
AA Change: Y337C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509
AA Change: Y337C

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
RhoGEF 82 261 3.86e-56 SMART
PH 294 402 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159021
SMART Domains Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 190 3.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159059
Predicted Effect probably damaging
Transcript: ENSMUST00000159747
AA Change: Y1708C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: Y1708C

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160855
SMART Domains Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 187 1.2e-21 PFAM
low complexity region 194 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162599
AA Change: Y481C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: Y481C

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
SH3 194 249 3.73e-16 SMART
Pfam:RhoGEF 304 405 1.2e-25 PFAM
PH 438 546 2.33e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162760
Predicted Effect probably benign
Transcript: ENSMUST00000167518
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193040
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Alg8 C T 7: 97,390,292 A410V probably benign Het
Armc8 A G 9: 99,536,207 V56A possibly damaging Het
Cactin T C 10: 81,323,678 I23T probably damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cfap54 T C 10: 92,821,038 I3051V probably benign Het
Cpxm1 A T 2: 130,396,444 I66N probably damaging Het
Ddx50 G A 10: 62,647,068 T74I possibly damaging Het
Dgcr14 G A 16: 17,902,205 R427* probably null Het
Dnah7b G T 1: 46,289,656 D3183Y possibly damaging Het
Dsg1b A G 18: 20,390,195 D93G probably damaging Het
Fam135a T G 1: 24,044,267 K292N probably damaging Het
Fam83b G T 9: 76,492,577 R415S probably benign Het
Fxyd3 T A 7: 31,073,621 M1L probably benign Het
Gm5134 T A 10: 75,978,381 M193K probably damaging Het
Golgb1 A G 16: 36,900,563 E427G possibly damaging Het
Gpat3 G A 5: 100,893,087 G338S probably damaging Het
Hmgxb3 C T 18: 61,150,433 R606Q probably damaging Het
Itgb1 T C 8: 128,717,676 probably null Het
Myh1 C A 11: 67,217,910 T1384K possibly damaging Het
Myo3b A C 2: 70,253,007 Q640P probably damaging Het
Naa16 A G 14: 79,359,527 V305A probably benign Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Pgap1 T C 1: 54,494,861 D631G probably benign Het
Phc2 C A 4: 128,743,555 P51Q probably damaging Het
Pmel G A 10: 128,718,992 probably null Het
Rassf8 G T 6: 145,815,190 G81W probably damaging Het
Rfx2 G T 17: 56,804,369 Q68K probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsbn1l A G 5: 20,920,018 L262S probably damaging Het
S100a16 A C 3: 90,542,084 Y22S probably damaging Het
Stx19 G A 16: 62,822,597 V259I possibly damaging Het
Tas2r105 T C 6: 131,686,941 I175V probably benign Het
Vmn2r67 T A 7: 85,152,823 H90L possibly damaging Het
Wscd1 T A 11: 71,760,174 L109Q probably damaging Het
Zfp423 T A 8: 87,686,442 Q1154L probably damaging Het
Zmym6 T C 4: 127,123,879 L1059P probably damaging Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 intron probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1669:Arhgef4 UTSW 1 34732158 missense possibly damaging 0.86
R1780:Arhgef4 UTSW 1 34724160 missense possibly damaging 0.73
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 unclassified probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R3697:Arhgef4 UTSW 1 34722440 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4684:Arhgef4 UTSW 1 34811785 unclassified probably null
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7087:Arhgef4 UTSW 1 34811686 missense probably damaging 0.96
R7297:Arhgef4 UTSW 1 34807192 missense probably damaging 1.00
R7525:Arhgef4 UTSW 1 34809704 missense probably damaging 1.00
R7614:Arhgef4 UTSW 1 34732235 missense possibly damaging 0.67
R7693:Arhgef4 UTSW 1 34724141 missense probably benign 0.01
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATCAAGTCTCCCTCTGCAAGCC -3'
(R):5'- AGTGAGCTACTCCCATCAGACTCAG -3'

Sequencing Primer
(F):5'- ATGCACGAAGCCTTCCTTG -3'
(R):5'- CCATCAGACTCAGTCAATAGGG -3'
Posted On2014-03-14