Incidental Mutation 'R1429:Tas2r105'
ID161436
Institutional Source Beutler Lab
Gene Symbol Tas2r105
Ensembl Gene ENSMUSG00000051153
Gene Nametaste receptor, type 2, member 105
SynonymsT2r5, Tas2r5, T2R05, T2R9, mGR05, mt2r5
MMRRC Submission 039485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R1429 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131686532-131687495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131686941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 175 (I175V)
Ref Sequence ENSEMBL: ENSMUSP00000058006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect probably benign
Transcript: ENSMUST00000053652
AA Change: I175V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153
AA Change: I175V

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation respond normally to a variety of bitter, sweet, umami, salty and sour stimuli but show a striking and selective impairement in their ability to taste cycloheximide (a bitter tastant). In addition, homozygotes are no longer behaviorally averse to cycloheximide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Alg8 C T 7: 97,390,292 A410V probably benign Het
Arhgef4 A G 1: 34,810,339 Y481C probably damaging Het
Armc8 A G 9: 99,536,207 V56A possibly damaging Het
Cactin T C 10: 81,323,678 I23T probably damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cfap54 T C 10: 92,821,038 I3051V probably benign Het
Cpxm1 A T 2: 130,396,444 I66N probably damaging Het
Ddx50 G A 10: 62,647,068 T74I possibly damaging Het
Dgcr14 G A 16: 17,902,205 R427* probably null Het
Dnah7b G T 1: 46,289,656 D3183Y possibly damaging Het
Dsg1b A G 18: 20,390,195 D93G probably damaging Het
Fam135a T G 1: 24,044,267 K292N probably damaging Het
Fam83b G T 9: 76,492,577 R415S probably benign Het
Fxyd3 T A 7: 31,073,621 M1L probably benign Het
Gm5134 T A 10: 75,978,381 M193K probably damaging Het
Golgb1 A G 16: 36,900,563 E427G possibly damaging Het
Gpat3 G A 5: 100,893,087 G338S probably damaging Het
Hmgxb3 C T 18: 61,150,433 R606Q probably damaging Het
Itgb1 T C 8: 128,717,676 probably null Het
Myh1 C A 11: 67,217,910 T1384K possibly damaging Het
Myo3b A C 2: 70,253,007 Q640P probably damaging Het
Naa16 A G 14: 79,359,527 V305A probably benign Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Pgap1 T C 1: 54,494,861 D631G probably benign Het
Phc2 C A 4: 128,743,555 P51Q probably damaging Het
Pmel G A 10: 128,718,992 probably null Het
Rassf8 G T 6: 145,815,190 G81W probably damaging Het
Rfx2 G T 17: 56,804,369 Q68K probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsbn1l A G 5: 20,920,018 L262S probably damaging Het
S100a16 A C 3: 90,542,084 Y22S probably damaging Het
Stx19 G A 16: 62,822,597 V259I possibly damaging Het
Vmn2r67 T A 7: 85,152,823 H90L possibly damaging Het
Wscd1 T A 11: 71,760,174 L109Q probably damaging Het
Zfp423 T A 8: 87,686,442 Q1154L probably damaging Het
Zmym6 T C 4: 127,123,879 L1059P probably damaging Het
Other mutations in Tas2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Tas2r105 APN 6 131687111 missense probably benign 0.02
IGL01148:Tas2r105 APN 6 131686852 missense probably damaging 1.00
IGL02882:Tas2r105 APN 6 131687180 missense possibly damaging 0.95
R0833:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R0836:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R2010:Tas2r105 UTSW 6 131687402 missense probably benign 0.41
R2418:Tas2r105 UTSW 6 131687447 missense probably damaging 1.00
R4023:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4026:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4742:Tas2r105 UTSW 6 131686851 missense probably damaging 1.00
R5497:Tas2r105 UTSW 6 131686842 splice site probably null
R5812:Tas2r105 UTSW 6 131686873 missense possibly damaging 0.95
R7191:Tas2r105 UTSW 6 131686982 missense probably damaging 0.99
R7236:Tas2r105 UTSW 6 131686760 missense probably damaging 1.00
R7482:Tas2r105 UTSW 6 131687009 missense probably benign 0.10
R8783:Tas2r105 UTSW 6 131686769 missense possibly damaging 0.92
X0067:Tas2r105 UTSW 6 131687270 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCACATGAGCTTCTGTGTTGAGGTC -3'
(R):5'- AGAAGGCATCCTCCTTTCCATTGC -3'

Sequencing Primer
(F):5'- AGGTCTCTGAATCCTGAAACAC -3'
(R):5'- TGGATGACTGTGAATCACCTGAC -3'
Posted On2014-03-14