Mutagenetix > Incidental Mutations

Incidental Mutation 'R1429:Rassf8'

161437

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

MMRRC Submission

039485-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R1429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 145815190 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 81 (G81W)

Ref Sequence

ENSEMBL: ENSMUSP00000107333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032388
AA Change: G81W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: G81W

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058538

Predicted Effect

probably damaging
Transcript: ENSMUST00000111704
AA Change: G81W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: G81W

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Alg8	C	T	7: 97,390,292	A410V	probably benign	Het
Arhgef4	A	G	1: 34,810,339	Y481C	probably damaging	Het
Armc8	A	G	9: 99,536,207	V56A	possibly damaging	Het
Cactin	T	C	10: 81,323,678	I23T	probably damaging	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cfap54	T	C	10: 92,821,038	I3051V	probably benign	Het
Cpxm1	A	T	2: 130,396,444	I66N	probably damaging	Het
Ddx50	G	A	10: 62,647,068	T74I	possibly damaging	Het
Dgcr14	G	A	16: 17,902,205	R427*	probably null	Het
Dnah7b	G	T	1: 46,289,656	D3183Y	possibly damaging	Het
Dsg1b	A	G	18: 20,390,195	D93G	probably damaging	Het
Fam135a	T	G	1: 24,044,267	K292N	probably damaging	Het
Fam83b	G	T	9: 76,492,577	R415S	probably benign	Het
Fxyd3	T	A	7: 31,073,621	M1L	probably benign	Het
Gm5134	T	A	10: 75,978,381	M193K	probably damaging	Het
Golgb1	A	G	16: 36,900,563	E427G	possibly damaging	Het
Gpat3	G	A	5: 100,893,087	G338S	probably damaging	Het
Hmgxb3	C	T	18: 61,150,433	R606Q	probably damaging	Het
Itgb1	T	C	8: 128,717,676		probably null	Het
Myh1	C	A	11: 67,217,910	T1384K	possibly damaging	Het
Myo3b	A	C	2: 70,253,007	Q640P	probably damaging	Het
Naa16	A	G	14: 79,359,527	V305A	probably benign	Het
Olfr183	G	A	16: 59,000,138	G151D	possibly damaging	Het
Pgap1	T	C	1: 54,494,861	D631G	probably benign	Het
Phc2	C	A	4: 128,743,555	P51Q	probably damaging	Het
Pmel	G	A	10: 128,718,992		probably null	Het
Rfx2	G	T	17: 56,804,369	Q68K	probably damaging	Het
Rps24	A	G	14: 24,491,762	T6A	probably damaging	Het
Rsbn1l	A	G	5: 20,920,018	L262S	probably damaging	Het
S100a16	A	C	3: 90,542,084	Y22S	probably damaging	Het
Stx19	G	A	16: 62,822,597	V259I	possibly damaging	Het
Tas2r105	T	C	6: 131,686,941	I175V	probably benign	Het
Vmn2r67	T	A	7: 85,152,823	H90L	possibly damaging	Het
Wscd1	T	A	11: 71,760,174	L109Q	probably damaging	Het
Zfp423	T	A	8: 87,686,442	Q1154L	probably damaging	Het
Zmym6	T	C	4: 127,123,879	L1059P	probably damaging	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCCTCCGCTGCATTACTGATGG -3'
(R):5'- AGCACCTTCTGCCTGAACTCAGTC -3'

Sequencing Primer
(F):5'- ACTGATGGTTGCATGTCCC -3'
(R):5'- AAAAATGTCCGTCAGCCCTTTG -3'

Posted On

2014-03-14