Incidental Mutation 'R1429:Alg8'
Institutional Source Beutler Lab
Gene Symbol Alg8
Ensembl Gene ENSMUSG00000035704
Gene Nameasparagine-linked glycosylation 8 (alpha-1,3-glucosyltransferase)
MMRRC Submission 039485-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1429 (G1)
Quality Score225
Status Not validated
Chromosomal Location97371606-97392185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97390292 bp
Amino Acid Change Alanine to Valine at position 410 (A410V)
Ref Sequence ENSEMBL: ENSMUSP00000095901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098300]
Predicted Effect probably benign
Transcript: ENSMUST00000098300
AA Change: A410V

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095901
Gene: ENSMUSG00000035704
AA Change: A410V

Pfam:Alg6_Alg8 21 510 1.3e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154107
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins. Mutations in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ih). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Arhgef4 A G 1: 34,810,339 Y481C probably damaging Het
Armc8 A G 9: 99,536,207 V56A possibly damaging Het
Cactin T C 10: 81,323,678 I23T probably damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cfap54 T C 10: 92,821,038 I3051V probably benign Het
Cpxm1 A T 2: 130,396,444 I66N probably damaging Het
Ddx50 G A 10: 62,647,068 T74I possibly damaging Het
Dgcr14 G A 16: 17,902,205 R427* probably null Het
Dnah7b G T 1: 46,289,656 D3183Y possibly damaging Het
Dsg1b A G 18: 20,390,195 D93G probably damaging Het
Fam135a T G 1: 24,044,267 K292N probably damaging Het
Fam83b G T 9: 76,492,577 R415S probably benign Het
Fxyd3 T A 7: 31,073,621 M1L probably benign Het
Gm5134 T A 10: 75,978,381 M193K probably damaging Het
Golgb1 A G 16: 36,900,563 E427G possibly damaging Het
Gpat3 G A 5: 100,893,087 G338S probably damaging Het
Hmgxb3 C T 18: 61,150,433 R606Q probably damaging Het
Itgb1 T C 8: 128,717,676 probably null Het
Myh1 C A 11: 67,217,910 T1384K possibly damaging Het
Myo3b A C 2: 70,253,007 Q640P probably damaging Het
Naa16 A G 14: 79,359,527 V305A probably benign Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Pgap1 T C 1: 54,494,861 D631G probably benign Het
Phc2 C A 4: 128,743,555 P51Q probably damaging Het
Pmel G A 10: 128,718,992 probably null Het
Rassf8 G T 6: 145,815,190 G81W probably damaging Het
Rfx2 G T 17: 56,804,369 Q68K probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsbn1l A G 5: 20,920,018 L262S probably damaging Het
S100a16 A C 3: 90,542,084 Y22S probably damaging Het
Stx19 G A 16: 62,822,597 V259I possibly damaging Het
Tas2r105 T C 6: 131,686,941 I175V probably benign Het
Vmn2r67 T A 7: 85,152,823 H90L possibly damaging Het
Wscd1 T A 11: 71,760,174 L109Q probably damaging Het
Zfp423 T A 8: 87,686,442 Q1154L probably damaging Het
Zmym6 T C 4: 127,123,879 L1059P probably damaging Het
Other mutations in Alg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Alg8 APN 7 97378176 missense possibly damaging 0.81
IGL02349:Alg8 APN 7 97379894 missense possibly damaging 0.95
IGL02441:Alg8 APN 7 97380297 missense probably benign 0.04
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R1109:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R3838:Alg8 UTSW 7 97388545 missense probably damaging 1.00
R5343:Alg8 UTSW 7 97386919 missense possibly damaging 0.53
R5622:Alg8 UTSW 7 97386799 splice site probably benign
R5910:Alg8 UTSW 7 97390286 missense possibly damaging 0.67
R5963:Alg8 UTSW 7 97379830 missense probably benign 0.00
R6484:Alg8 UTSW 7 97382928 missense probably benign
R6735:Alg8 UTSW 7 97382982 missense probably benign 0.05
R7896:Alg8 UTSW 7 97390916 missense probably damaging 1.00
R7957:Alg8 UTSW 7 97390924 missense probably benign 0.04
R7958:Alg8 UTSW 7 97386921 missense possibly damaging 0.65
Z1176:Alg8 UTSW 7 97383761 missense probably benign 0.01
Z1177:Alg8 UTSW 7 97371662 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cactcactgtctgctcttcc -3'
Posted On2014-03-14