Incidental Mutation 'R1430:Psenen'
ID161479
Institutional Source Beutler Lab
Gene Symbol Psenen
Ensembl Gene ENSMUSG00000036835
Gene Namepresenilin enhancer gamma secretase subunit
Synonyms
MMRRC Submission 039486-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1430 (G1)
Quality Score222
Status Validated
Chromosome7
Chromosomal Location30561863-30563627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30562390 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 34 (I34V)
Ref Sequence ENSEMBL: ENSMUSP00000146469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043273] [ENSMUST00000043850] [ENSMUST00000043898] [ENSMUST00000043975] [ENSMUST00000108161] [ENSMUST00000108164] [ENSMUST00000156241] [ENSMUST00000163276] [ENSMUST00000163330] [ENSMUST00000163464] [ENSMUST00000163482] [ENSMUST00000163654] [ENSMUST00000163848] [ENSMUST00000164365] [ENSMUST00000166257] [ENSMUST00000166510] [ENSMUST00000166960] [ENSMUST00000167042] [ENSMUST00000167202] [ENSMUST00000167361] [ENSMUST00000167501] [ENSMUST00000168229] [ENSMUST00000168333] [ENSMUST00000168555] [ENSMUST00000168931] [ENSMUST00000171850] [ENSMUST00000171912] [ENSMUST00000172251] [ENSMUST00000207031] [ENSMUST00000207747] [ENSMUST00000207797] [ENSMUST00000208628]
Predicted Effect probably benign
Transcript: ENSMUST00000043273
SMART Domains Protein: ENSMUSP00000039406
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043850
SMART Domains Protein: ENSMUSP00000042312
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043898
AA Change: I34V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044682
Gene: ENSMUSG00000036835
AA Change: I34V

DomainStartEndE-ValueType
Pfam:PEN-2 7 99 2.9e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043975
SMART Domains Protein: ENSMUSP00000048557
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 84 240 5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108161
SMART Domains Protein: ENSMUSP00000103796
Gene: ENSMUSG00000109378

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 8.8e-10 PFAM
SCOP:d1jmta_ 43 115 2e-17 SMART
PDB:1JMT|A 43 116 3e-40 PDB
Blast:RRM 45 116 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108164
SMART Domains Protein: ENSMUSP00000103799
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 58 229 1.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149400
Predicted Effect probably benign
Transcript: ENSMUST00000156241
SMART Domains Protein: ENSMUSP00000122248
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 80 202 7.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163276
Predicted Effect probably benign
Transcript: ENSMUST00000163330
SMART Domains Protein: ENSMUSP00000129385
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
RRM 39 116 5.99e-4 SMART
Pfam:zf-CCCH 122 148 4.9e-8 PFAM
low complexity region 160 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163464
SMART Domains Protein: ENSMUSP00000125959
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 171 3.95e1 SMART
low complexity region 183 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163482
SMART Domains Protein: ENSMUSP00000130649
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163654
SMART Domains Protein: ENSMUSP00000131048
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 1.3e-9 PFAM
RRM 66 143 5.99e-4 SMART
low complexity region 167 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163994
Predicted Effect probably benign
Transcript: ENSMUST00000164365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165543
Predicted Effect probably benign
Transcript: ENSMUST00000165722
SMART Domains Protein: ENSMUSP00000125790
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 1 26 4.7e-10 PFAM
PDB:1JMT|A 30 51 2e-6 PDB
SCOP:d1jmta_ 30 51 5e-3 SMART
Blast:RRM 32 53 7e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165773
Predicted Effect probably benign
Transcript: ENSMUST00000166257
SMART Domains Protein: ENSMUSP00000125838
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 33 104 2.35e-2 SMART
ZnF_C3H1 110 136 2.49e-1 SMART
low complexity region 148 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166510
SMART Domains Protein: ENSMUSP00000132316
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 45 133 2.51e-6 SMART
ZnF_C3H1 139 165 2.49e-1 SMART
low complexity region 177 209 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166864
Predicted Effect probably benign
Transcript: ENSMUST00000166960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167024
Predicted Effect probably benign
Transcript: ENSMUST00000167042
SMART Domains Protein: ENSMUSP00000128886
Gene: ENSMUSG00000109378

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167202
Predicted Effect probably benign
Transcript: ENSMUST00000167361
Predicted Effect probably benign
Transcript: ENSMUST00000167501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168222
Predicted Effect probably benign
Transcript: ENSMUST00000168229
Predicted Effect probably benign
Transcript: ENSMUST00000168333
SMART Domains Protein: ENSMUSP00000128950
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 4.8e-10 PFAM
PDB:1JMT|A 43 94 5e-21 PDB
SCOP:d1jmta_ 43 94 2e-9 SMART
Blast:RRM 45 94 5e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168555
Predicted Effect probably benign
Transcript: ENSMUST00000168931
SMART Domains Protein: ENSMUSP00000129697
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
RRM 44 119 4.14e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171364
Predicted Effect probably benign
Transcript: ENSMUST00000171850
SMART Domains Protein: ENSMUSP00000131781
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
PDB:1JMT|A 43 113 1e-16 PDB
SCOP:d1jmta_ 43 113 1e-9 SMART
Blast:RRM 45 110 3e-17 BLAST
ZnF_C3H1 116 142 2.49e-1 SMART
low complexity region 154 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171912
SMART Domains Protein: ENSMUSP00000130983
Gene: ENSMUSG00000109378

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172251
SMART Domains Protein: ENSMUSP00000132400
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
low complexity region 267 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207031
Predicted Effect probably benign
Transcript: ENSMUST00000207747
AA Change: I34V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207797
AA Change: I34V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207972
Predicted Effect probably benign
Transcript: ENSMUST00000208628
AA Change: I34V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209110
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Presenilins, which are components of the gamma-secretase protein complex, are required for intramembranous processing of some type I transmembrane proteins, such as the Notch proteins and the beta-amyloid precursor protein. Signaling by Notch receptors mediates a wide range of developmental cell fates. Processing of the beta-amyloid precursor protein generates neurotoxic amyloid beta peptides, the major component of senile plaques associated with Alzheimer's disease. This gene encodes a protein that is required for Notch pathway signaling, and for the activity and accumulation of gamma-secretase. Mutations resulting in haploinsufficiency for this gene cause familial acne inversa-2 (ACNINV2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,714,271 probably benign Het
Aoc2 A G 11: 101,326,495 Y468C probably damaging Het
Cdyl2 A G 8: 116,579,317 probably benign Het
Cfh A G 1: 140,102,698 probably benign Het
Cyp2j9 G T 4: 96,583,964 probably benign Het
Dapk1 T G 13: 60,754,143 F929V probably benign Het
Dhx9 A T 1: 153,483,747 M35K probably benign Het
Dnah5 G A 15: 28,345,857 E2448K probably benign Het
Doc2b A T 11: 75,780,155 C217S possibly damaging Het
Dock11 A G X: 36,069,912 I2010V probably benign Het
Dram1 T C 10: 88,324,779 T227A possibly damaging Het
Eppin G A 2: 164,589,403 T101M probably damaging Het
F13a1 T C 13: 36,898,131 D533G probably damaging Het
Fmo1 C A 1: 162,839,724 R174L probably damaging Het
Fsip2 C A 2: 82,998,063 L6735I possibly damaging Het
Gab1 G T 8: 80,788,612 T359K probably benign Het
Ggta1 T C 2: 35,408,017 D118G possibly damaging Het
Gramd1a A G 7: 31,132,786 S609P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrrc24 G T 15: 76,723,792 probably null Het
Mak C A 13: 41,070,284 probably benign Het
Megf8 G A 7: 25,364,343 R2708Q possibly damaging Het
Mettl24 T C 10: 40,737,795 C177R probably damaging Het
Mgam G C 6: 40,756,371 E812D probably benign Het
Mroh8 T C 2: 157,269,525 R170G possibly damaging Het
Msn G A X: 96,152,719 V130I probably benign Het
Ncoa4 G A 14: 32,176,722 V500I probably benign Het
Olfr10 A G 11: 49,318,101 probably null Het
Olfr1087 T C 2: 86,690,522 Y151C possibly damaging Het
Olfr1440 C T 19: 12,394,437 T58I probably benign Het
Olfr170 A G 16: 19,606,002 L222P probably damaging Het
Ppm1h T C 10: 122,857,099 S302P probably damaging Het
Prkce T A 17: 86,559,137 probably benign Het
Rbl1 T C 2: 157,169,906 T710A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Slc1a5 A G 7: 16,782,403 D168G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Syce1 A T 7: 140,779,438 probably benign Het
Tbc1d23 G T 16: 57,214,210 D75E probably damaging Het
Tbk1 A G 10: 121,559,934 V418A probably benign Het
Tmem132e T C 11: 82,438,296 V467A probably damaging Het
Tmem241 T C 18: 11,993,594 D144G probably benign Het
Tsc2 A G 17: 24,599,023 probably null Het
Ubxn4 T A 1: 128,274,880 F420I probably benign Het
Usp34 A G 11: 23,459,151 T2645A probably damaging Het
Utp14b A G 1: 78,666,394 K670E probably benign Het
Zfp407 C T 18: 84,209,455 V2010M probably benign Het
Zfp879 A G 11: 50,833,957 F91L probably benign Het
Zfyve26 A G 12: 79,282,817 S532P probably benign Het
Other mutations in Psenen
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Psenen UTSW 7 30562377 missense possibly damaging 0.79
R6572:Psenen UTSW 7 30562348 missense probably benign 0.00
R6994:Psenen UTSW 7 30563507 critical splice donor site probably null
X0065:Psenen UTSW 7 30562847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCCGTTCATCTCTGACACAG -3'
(R):5'- AATCACAGTCCCAATGAGCAGGAAG -3'

Sequencing Primer
(F):5'- GTTCATCTCTGACACAGATCTCC -3'
(R):5'- GGAGACAGTCCTTAGATTAGAGC -3'
Posted On2014-03-14