Incidental Mutation 'R1430:Syce1'
ID161481
Institutional Source Beutler Lab
Gene Symbol Syce1
Ensembl Gene ENSMUSG00000025480
Gene Namesynaptonemal complex central element protein 1
Synonyms4933406J07Rik
MMRRC Submission 039486-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1430 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140777229-140787852 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 140779438 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000210235] [ENSMUST00000211616]
Predicted Effect probably benign
Transcript: ENSMUST00000026552
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026553
SMART Domains Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480

DomainStartEndE-ValueType
Pfam:SYCE1 49 200 5.5e-66 PFAM
coiled coil region 237 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209253
Predicted Effect probably benign
Transcript: ENSMUST00000210235
Predicted Effect probably benign
Transcript: ENSMUST00000211616
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptonemal complex, which links homologous chromosomes during prophase I of meiosis. The tripartite structure of the complex is highly conserved amongst metazoans. It consists of two lateral elements and a central region formed by transverse elements and a central element. The protein encoded by this gene localizes to the central element and is required for initiation and elongation of the synapsis. Allelic variants of this gene have been associated with premature ovarian failure and spermatogenic failure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit small ovaries and small testes, severe defects in gametogenesis, and infertility in both sexes. Meiosis is arrested, homologous chromosomes fail to synapse, and meiotic double-strand breaks are formed but are notefficiently repaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,714,271 probably benign Het
Aoc2 A G 11: 101,326,495 Y468C probably damaging Het
Cdyl2 A G 8: 116,579,317 probably benign Het
Cfh A G 1: 140,102,698 probably benign Het
Cyp2j9 G T 4: 96,583,964 probably benign Het
Dapk1 T G 13: 60,754,143 F929V probably benign Het
Dhx9 A T 1: 153,483,747 M35K probably benign Het
Dnah5 G A 15: 28,345,857 E2448K probably benign Het
Doc2b A T 11: 75,780,155 C217S possibly damaging Het
Dock11 A G X: 36,069,912 I2010V probably benign Het
Dram1 T C 10: 88,324,779 T227A possibly damaging Het
Eppin G A 2: 164,589,403 T101M probably damaging Het
F13a1 T C 13: 36,898,131 D533G probably damaging Het
Fmo1 C A 1: 162,839,724 R174L probably damaging Het
Fsip2 C A 2: 82,998,063 L6735I possibly damaging Het
Gab1 G T 8: 80,788,612 T359K probably benign Het
Ggta1 T C 2: 35,408,017 D118G possibly damaging Het
Gramd1a A G 7: 31,132,786 S609P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrrc24 G T 15: 76,723,792 probably null Het
Mak C A 13: 41,070,284 probably benign Het
Megf8 G A 7: 25,364,343 R2708Q possibly damaging Het
Mettl24 T C 10: 40,737,795 C177R probably damaging Het
Mgam G C 6: 40,756,371 E812D probably benign Het
Mroh8 T C 2: 157,269,525 R170G possibly damaging Het
Msn G A X: 96,152,719 V130I probably benign Het
Ncoa4 G A 14: 32,176,722 V500I probably benign Het
Olfr10 A G 11: 49,318,101 probably null Het
Olfr1087 T C 2: 86,690,522 Y151C possibly damaging Het
Olfr1440 C T 19: 12,394,437 T58I probably benign Het
Olfr170 A G 16: 19,606,002 L222P probably damaging Het
Ppm1h T C 10: 122,857,099 S302P probably damaging Het
Prkce T A 17: 86,559,137 probably benign Het
Psenen T C 7: 30,562,390 I34V probably benign Het
Rbl1 T C 2: 157,169,906 T710A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Slc1a5 A G 7: 16,782,403 D168G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tbc1d23 G T 16: 57,214,210 D75E probably damaging Het
Tbk1 A G 10: 121,559,934 V418A probably benign Het
Tmem132e T C 11: 82,438,296 V467A probably damaging Het
Tmem241 T C 18: 11,993,594 D144G probably benign Het
Tsc2 A G 17: 24,599,023 probably null Het
Ubxn4 T A 1: 128,274,880 F420I probably benign Het
Usp34 A G 11: 23,459,151 T2645A probably damaging Het
Utp14b A G 1: 78,666,394 K670E probably benign Het
Zfp407 C T 18: 84,209,455 V2010M probably benign Het
Zfp879 A G 11: 50,833,957 F91L probably benign Het
Zfyve26 A G 12: 79,282,817 S532P probably benign Het
Other mutations in Syce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02112:Syce1 APN 7 140779632 missense probably benign
IGL03304:Syce1 APN 7 140777710 missense possibly damaging 0.67
R0918:Syce1 UTSW 7 140780523 missense probably damaging 1.00
R1106:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R1169:Syce1 UTSW 7 140778207 missense probably benign 0.00
R1436:Syce1 UTSW 7 140777680 missense possibly damaging 0.84
R1650:Syce1 UTSW 7 140778387 missense possibly damaging 0.62
R2081:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R2082:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3890:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3891:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4006:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4007:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4077:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4078:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4079:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4817:Syce1 UTSW 7 140778423 missense probably benign 0.00
R4824:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R5040:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R5766:Syce1 UTSW 7 140777981 missense probably damaging 1.00
R6380:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R7048:Syce1 UTSW 7 140779368 missense possibly damaging 0.73
Y4338:Syce1 UTSW 7 140779896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATAGCTTCACCCCTTGACCATC -3'
(R):5'- GCACTCAGAGGGCACTGTTGTTATC -3'

Sequencing Primer
(F):5'- TTGACCATCCAGGACTATGGC -3'
(R):5'- CTTACAGAGACCCTGAGGATTATGC -3'
Posted On2014-03-14