Incidental Mutation 'R1430:Lrrc24'
ID161502
Institutional Source Beutler Lab
Gene Symbol Lrrc24
Ensembl Gene ENSMUSG00000033707
Gene Nameleucine rich repeat containing 24
Synonyms
MMRRC Submission 039486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1430 (G1)
Quality Score195
Status Validated
Chromosome15
Chromosomal Location76715276-76722173 bp(-) (GRCm38)
Type of Mutationunclassified (193 bp from exon)
DNA Base Change (assembly) G to T at 76723792 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000036247] [ENSMUST00000049956] [ENSMUST00000077821] [ENSMUST00000228990]
Predicted Effect probably null
Transcript: ENSMUST00000036176
SMART Domains Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 759 904 2.3e-32 PFAM
RhoGAP 932 1105 5.9e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036247
AA Change: R9S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039910
Gene: ENSMUSG00000116138
AA Change: R9S

DomainStartEndE-ValueType
Pfam:DUF4505 31 209 5.4e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049956
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077821
SMART Domains Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 756 874 3.3e-25 PFAM
RhoGAP 901 1074 5.9e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176724
Predicted Effect possibly damaging
Transcript: ENSMUST00000228990
AA Change: R9S

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231059
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,714,271 probably benign Het
Aoc2 A G 11: 101,326,495 Y468C probably damaging Het
Cdyl2 A G 8: 116,579,317 probably benign Het
Cfh A G 1: 140,102,698 probably benign Het
Cyp2j9 G T 4: 96,583,964 probably benign Het
Dapk1 T G 13: 60,754,143 F929V probably benign Het
Dhx9 A T 1: 153,483,747 M35K probably benign Het
Dnah5 G A 15: 28,345,857 E2448K probably benign Het
Doc2b A T 11: 75,780,155 C217S possibly damaging Het
Dock11 A G X: 36,069,912 I2010V probably benign Het
Dram1 T C 10: 88,324,779 T227A possibly damaging Het
Eppin G A 2: 164,589,403 T101M probably damaging Het
F13a1 T C 13: 36,898,131 D533G probably damaging Het
Fmo1 C A 1: 162,839,724 R174L probably damaging Het
Fsip2 C A 2: 82,998,063 L6735I possibly damaging Het
Gab1 G T 8: 80,788,612 T359K probably benign Het
Ggta1 T C 2: 35,408,017 D118G possibly damaging Het
Gramd1a A G 7: 31,132,786 S609P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Mak C A 13: 41,070,284 probably benign Het
Megf8 G A 7: 25,364,343 R2708Q possibly damaging Het
Mettl24 T C 10: 40,737,795 C177R probably damaging Het
Mgam G C 6: 40,756,371 E812D probably benign Het
Mroh8 T C 2: 157,269,525 R170G possibly damaging Het
Msn G A X: 96,152,719 V130I probably benign Het
Ncoa4 G A 14: 32,176,722 V500I probably benign Het
Olfr10 A G 11: 49,318,101 probably null Het
Olfr1087 T C 2: 86,690,522 Y151C possibly damaging Het
Olfr1440 C T 19: 12,394,437 T58I probably benign Het
Olfr170 A G 16: 19,606,002 L222P probably damaging Het
Ppm1h T C 10: 122,857,099 S302P probably damaging Het
Prkce T A 17: 86,559,137 probably benign Het
Psenen T C 7: 30,562,390 I34V probably benign Het
Rbl1 T C 2: 157,169,906 T710A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Slc1a5 A G 7: 16,782,403 D168G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Syce1 A T 7: 140,779,438 probably benign Het
Tbc1d23 G T 16: 57,214,210 D75E probably damaging Het
Tbk1 A G 10: 121,559,934 V418A probably benign Het
Tmem132e T C 11: 82,438,296 V467A probably damaging Het
Tmem241 T C 18: 11,993,594 D144G probably benign Het
Tsc2 A G 17: 24,599,023 probably null Het
Ubxn4 T A 1: 128,274,880 F420I probably benign Het
Usp34 A G 11: 23,459,151 T2645A probably damaging Het
Utp14b A G 1: 78,666,394 K670E probably benign Het
Zfp407 C T 18: 84,209,455 V2010M probably benign Het
Zfp879 A G 11: 50,833,957 F91L probably benign Het
Zfyve26 A G 12: 79,282,817 S532P probably benign Het
Other mutations in Lrrc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Lrrc24 APN 15 76718063 missense probably damaging 1.00
IGL01556:Lrrc24 APN 15 76722575 missense probably damaging 0.99
IGL01940:Lrrc24 APN 15 76716057 missense probably damaging 1.00
IGL01966:Lrrc24 APN 15 76718311 missense probably benign 0.22
IGL02315:Lrrc24 APN 15 76718306 missense probably damaging 1.00
IGL03062:Lrrc24 APN 15 76718304 missense probably benign
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0365:Lrrc24 UTSW 15 76715784 missense probably benign 0.14
R1789:Lrrc24 UTSW 15 76722578 missense probably benign 0.02
R2131:Lrrc24 UTSW 15 76715581 missense possibly damaging 0.92
R2202:Lrrc24 UTSW 15 76722911 missense probably damaging 1.00
R4247:Lrrc24 UTSW 15 76717976 missense possibly damaging 0.89
R4585:Lrrc24 UTSW 15 76723689 missense probably damaging 1.00
R4944:Lrrc24 UTSW 15 76718346 missense probably damaging 1.00
R4976:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5119:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5445:Lrrc24 UTSW 15 76716106 missense probably benign 0.10
R5772:Lrrc24 UTSW 15 76722710 missense probably damaging 1.00
R7795:Lrrc24 UTSW 15 76718048 missense probably benign 0.43
X0028:Lrrc24 UTSW 15 76715913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCCGGAATTAACTCTTCCAG -3'
(R):5'- GGGACAGTGCTCCGTGTGAATAAAG -3'

Sequencing Primer
(F):5'- TTTGAAAGGTTCAAAGCCACGC -3'
(R):5'- GCTCCGTGTGAATAAAGTTCAAG -3'
Posted On2014-03-14