Incidental Mutation 'R1442:Klhdc8a'
ID161514
Institutional Source Beutler Lab
Gene Symbol Klhdc8a
Ensembl Gene ENSMUSG00000042115
Gene Namekelch domain containing 8A
SynonymsA630065K24Rik
MMRRC Submission 039497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1442 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132298626-132307357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132302647 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 167 (A167T)
Ref Sequence ENSEMBL: ENSMUSP00000038297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046071
AA Change: A167T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038297
Gene: ENSMUSG00000042115
AA Change: A167T

DomainStartEndE-ValueType
Kelch 32 79 1.05e-11 SMART
Kelch 80 127 1.1e-1 SMART
Kelch 128 174 9.37e-2 SMART
Kelch 176 222 8.34e-6 SMART
Blast:Kelch 224 278 3e-9 BLAST
Kelch 279 326 6.82e-11 SMART
Meta Mutation Damage Score 0.3666 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kelch domain-containing protein which is upregulated in cancer. Upregulated expression of the encoded protein may provide an alternative pathway for tumors to maintain aggressiveness in the absence of epidermal growth factor receptor dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8a2 A C 14: 59,860,323 probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
C8a T A 4: 104,828,078 T323S possibly damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Irf7 T C 7: 141,264,022 T246A probably damaging Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Smtnl1 T A 2: 84,818,436 D158V probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Ubr5 G A 15: 38,014,924 probably benign Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vegfa G A 17: 46,025,492 T56I possibly damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Zmym2 T C 14: 56,943,327 Y899H probably damaging Het
Other mutations in Klhdc8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Klhdc8a APN 1 132303018 missense probably benign
IGL01106:Klhdc8a APN 1 132304700 missense probably benign 0.01
IGL02512:Klhdc8a APN 1 132303157 critical splice donor site probably null
R0015:Klhdc8a UTSW 1 132303005 missense probably damaging 0.99
R1845:Klhdc8a UTSW 1 132303810 missense possibly damaging 0.80
R4857:Klhdc8a UTSW 1 132303105 missense probably damaging 1.00
R6357:Klhdc8a UTSW 1 132303153 missense probably damaging 0.99
R7226:Klhdc8a UTSW 1 132302606 missense probably damaging 1.00
R7427:Klhdc8a UTSW 1 132302967 missense probably damaging 1.00
R8039:Klhdc8a UTSW 1 132303108 missense not run
Predicted Primers PCR Primer
(F):5'- CGCAGGTTCAGGAAGATTAGCCAG -3'
(R):5'- AGACTCCTCAAGGCTAGGGCAATG -3'

Sequencing Primer
(F):5'- AGAGACTTTAAATGGTGCTCCCC -3'
(R):5'- TCAAGGCTAGGGCAATGTGATTATC -3'
Posted On2014-03-14