Incidental Mutation 'R1442:Smtnl1'
ID161520
Institutional Source Beutler Lab
Gene Symbol Smtnl1
Ensembl Gene ENSMUSG00000027077
Gene Namesmoothelin-like 1
SynonymsChasm, 1110030K22Rik
MMRRC Submission 039497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1442 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84811176-84822652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84818436 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 158 (D158V)
Ref Sequence ENSEMBL: ENSMUSP00000028471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028471]
PDB Structure
The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000028471
AA Change: D158V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: D158V

DomainStartEndE-ValueType
low complexity region 56 72 N/A INTRINSIC
coiled coil region 124 154 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 260 285 N/A INTRINSIC
CH 345 444 5.55e-18 SMART
Meta Mutation Damage Score 0.2972 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8a2 A C 14: 59,860,323 probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
C8a T A 4: 104,828,078 T323S possibly damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Irf7 T C 7: 141,264,022 T246A probably damaging Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Klhdc8a G A 1: 132,302,647 A167T possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Ubr5 G A 15: 38,014,924 probably benign Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vegfa G A 17: 46,025,492 T56I possibly damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Zmym2 T C 14: 56,943,327 Y899H probably damaging Het
Other mutations in Smtnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Smtnl1 APN 2 84818887 missense probably benign
IGL01702:Smtnl1 APN 2 84818690 missense possibly damaging 0.71
IGL01836:Smtnl1 APN 2 84815370 missense probably damaging 1.00
IGL01866:Smtnl1 APN 2 84818745 missense possibly damaging 0.80
IGL01869:Smtnl1 APN 2 84811397 makesense probably null
IGL01989:Smtnl1 APN 2 84818470 missense probably benign 0.22
IGL02247:Smtnl1 APN 2 84817028 splice site probably benign
R4577:Smtnl1 UTSW 2 84818443 missense possibly damaging 0.50
R5340:Smtnl1 UTSW 2 84815441 missense probably damaging 1.00
R5524:Smtnl1 UTSW 2 84818894 missense probably benign 0.05
R5561:Smtnl1 UTSW 2 84818395 missense probably benign 0.31
R5631:Smtnl1 UTSW 2 84818754 missense probably benign
R5997:Smtnl1 UTSW 2 84815378 missense probably damaging 1.00
R6050:Smtnl1 UTSW 2 84811453 missense probably damaging 1.00
R6433:Smtnl1 UTSW 2 84818368 missense probably benign 0.03
R7011:Smtnl1 UTSW 2 84818409 missense probably benign 0.01
R8390:Smtnl1 UTSW 2 84815350 nonsense probably null
R8406:Smtnl1 UTSW 2 84818398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCTTACTCACCACCAACTCCT -3'
(R):5'- GTAAAGCAGCATCTAAGAGTGGCGAA -3'

Sequencing Primer
(F):5'- ACTCACCACCAACTCCTTTGTG -3'
(R):5'- CAGGGTGACCTTGCTGAG -3'
Posted On2014-03-14