Mutagenetix > Incidental Mutations

Incidental Mutation 'R1442:Smtnl1'

161520

Institutional Source

Beutler Lab

Gene Symbol

Smtnl1

Ensembl Gene

ENSMUSG00000027077

Gene Name

smoothelin-like 1

Synonyms

Chasm, 1110030K22Rik

MMRRC Submission

039497-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1442 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84811176-84822652 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84818436 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 158 (D158V)

Ref Sequence

ENSEMBL: ENSMUSP00000028471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028471]

PDB Structure

The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028471
AA Change: D158V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: D158V

Domain	Start	End	E-Value	Type
low complexity region	56	72	N/A	INTRINSIC
coiled coil region	124	154	N/A	INTRINSIC
low complexity region	218	230	N/A	INTRINSIC
low complexity region	236	246	N/A	INTRINSIC
low complexity region	260	285	N/A	INTRINSIC
CH	345	444	5.55e-18	SMART

Meta Mutation Damage Score

0.2972

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,955,632		probably benign	Het
Adamts7	T	A	9: 90,188,770	I648N	probably damaging	Het
Akap13	T	A	7: 75,735,778	F2252I	probably damaging	Het
Akr1c6	A	T	13: 4,457,160	H314L	probably damaging	Het
Anxa3	T	A	5: 96,828,690		probably null	Het
Apob	T	G	12: 7,986,165	F298V	probably benign	Het
Atp8a2	A	C	14: 59,860,323		probably benign	Het
Atp8b5	A	T	4: 43,334,313	T360S	probably damaging	Het
BC051665	A	T	13: 60,784,741	N43K	probably benign	Het
Bicral	T	A	17: 46,801,724	H850L	probably benign	Het
C1qtnf1	A	G	11: 118,448,185	D227G	probably damaging	Het
C8a	T	A	4: 104,828,078	T323S	possibly damaging	Het
Cep89	T	C	7: 35,418,211		probably benign	Het
Cercam	G	T	2: 29,880,640	V408L	probably benign	Het
CN725425	G	A	15: 91,238,955	V76M	possibly damaging	Het
Cops7b	T	A	1: 86,605,113	M231K	probably benign	Het
Cpa2	T	A	6: 30,544,866		probably null	Het
Dab2ip	A	T	2: 35,710,256	I287F	probably damaging	Het
Defb10	A	T	8: 21,858,928	M1L	probably benign	Het
Dscam	C	A	16: 96,608,074	R1883L	possibly damaging	Het
Dsg4	T	A	18: 20,462,660	I640N	possibly damaging	Het
Duox2	G	C	2: 122,281,751	P1318R	probably benign	Het
Dzip3	T	C	16: 48,945,622	D466G	probably benign	Het
E230025N22Rik	T	A	18: 36,691,409		probably null	Het
E2f3	A	G	13: 29,918,669	L80P	probably damaging	Het
Eif2b2	T	C	12: 85,219,586	S9P	probably benign	Het
Etaa1	A	T	11: 17,947,201	D305E	probably benign	Het
Fads6	C	A	11: 115,297,409	R23L	probably benign	Het
Flrt2	T	C	12: 95,780,205	V439A	probably damaging	Het
Galm	A	C	17: 80,145,185	Q184P	probably damaging	Het
Gtse1	C	T	15: 85,860,102		probably benign	Het
Irf7	T	C	7: 141,264,022	T246A	probably damaging	Het
Kif28	A	G	1: 179,705,132	V639A	possibly damaging	Het
Klhdc8a	G	A	1: 132,302,647	A167T	possibly damaging	Het
Lrfn3	T	C	7: 30,360,044	H252R	probably benign	Het
Lzts1	G	T	8: 69,138,986	A170E	probably damaging	Het
Mphosph9	T	A	5: 124,265,398	I856F	possibly damaging	Het
Mroh2a	C	T	1: 88,232,353		probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Myh3	A	G	11: 67,087,277	N392D	possibly damaging	Het
Naalad2	T	C	9: 18,351,032		probably benign	Het
Npc1	T	A	18: 12,195,049	M1068L	probably benign	Het
Nupl1	T	A	14: 60,232,543		probably benign	Het
Olfr1286	A	T	2: 111,420,093	I286N	probably damaging	Het
Olfr285	T	C	15: 98,313,187	Y121C	probably damaging	Het
Olfr906	A	T	9: 38,488,643	I205F	probably benign	Het
Olfr95	T	C	17: 37,211,704	T50A	probably benign	Het
Parp2	T	G	14: 50,819,275		probably null	Het
Ppp4r4	T	C	12: 103,598,245	V9A	probably damaging	Het
Ptprc	T	A	1: 138,072,312	D856V	probably damaging	Het
Ptpru	T	A	4: 131,808,269	T466S	probably benign	Het
Rhob	A	G	12: 8,499,325	V103A	possibly damaging	Het
Sec23ip	A	C	7: 128,776,786	S775R	probably benign	Het
Slit2	T	G	5: 48,238,383	D709E	probably damaging	Het
Smok2b	C	G	17: 13,235,503	I183M	probably damaging	Het
Syne2	T	C	12: 75,946,715	I2087T	probably damaging	Het
Tada1	G	A	1: 166,386,750	R106H	possibly damaging	Het
Tecta	T	A	9: 42,332,482	I2025F	probably damaging	Het
Themis	T	C	10: 28,782,135	V386A	probably damaging	Het
Ubr5	G	A	15: 38,014,924		probably benign	Het
Vcl	T	A	14: 20,983,378	I134N	probably damaging	Het
Vegfa	G	A	17: 46,025,492	T56I	possibly damaging	Het
Vmn2r108	T	A	17: 20,472,361	K78*	probably null	Het
Vmn2r82	A	T	10: 79,379,367	T395S	probably benign	Het
Wbp2nl	T	C	15: 82,314,206	S315P	probably benign	Het
Zfp566	T	C	7: 30,077,919	Y279C	probably damaging	Het
Zmym2	T	C	14: 56,943,327	Y899H	probably damaging	Het

Other mutations in Smtnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01135:Smtnl1	APN	2	84818887	missense	probably benign
IGL01702:Smtnl1	APN	2	84818690	missense	possibly damaging	0.71
IGL01836:Smtnl1	APN	2	84815370	missense	probably damaging	1.00
IGL01866:Smtnl1	APN	2	84818745	missense	possibly damaging	0.80
IGL01869:Smtnl1	APN	2	84811397	makesense	probably null
IGL01989:Smtnl1	APN	2	84818470	missense	probably benign	0.22
IGL02247:Smtnl1	APN	2	84817028	splice site	probably benign
R4577:Smtnl1	UTSW	2	84818443	missense	possibly damaging	0.50
R5340:Smtnl1	UTSW	2	84815441	missense	probably damaging	1.00
R5524:Smtnl1	UTSW	2	84818894	missense	probably benign	0.05
R5561:Smtnl1	UTSW	2	84818395	missense	probably benign	0.31
R5631:Smtnl1	UTSW	2	84818754	missense	probably benign
R5997:Smtnl1	UTSW	2	84815378	missense	probably damaging	1.00
R6050:Smtnl1	UTSW	2	84811453	missense	probably damaging	1.00
R6433:Smtnl1	UTSW	2	84818368	missense	probably benign	0.03
R7011:Smtnl1	UTSW	2	84818409	missense	probably benign	0.01
R8390:Smtnl1	UTSW	2	84815350	nonsense	probably null
R8406:Smtnl1	UTSW	2	84818398	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCCTTACTCACCACCAACTCCT -3'
(R):5'- GTAAAGCAGCATCTAAGAGTGGCGAA -3'

Sequencing Primer
(F):5'- ACTCACCACCAACTCCTTTGTG -3'
(R):5'- CAGGGTGACCTTGCTGAG -3'

Posted On

2014-03-14