Incidental Mutation 'R1442:C8a'
ID161524
Institutional Source Beutler Lab
Gene Symbol C8a
Ensembl Gene ENSMUSG00000035031
Gene Namecomplement component 8, alpha polypeptide
Synonyms
MMRRC Submission 039497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1442 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location104815679-104876398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104828078 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 323 (T323S)
Ref Sequence ENSEMBL: ENSMUSP00000102420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048947] [ENSMUST00000064873] [ENSMUST00000106808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048947
AA Change: T367S

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047606
Gene: ENSMUSG00000035031
AA Change: T367S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 3e-13 BLAST
Blast:TSP1 545 573 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000064873
AA Change: T367S

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067541
Gene: ENSMUSG00000035031
AA Change: T367S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 4e-13 BLAST
TSP1 545 587 1.86e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106808
AA Change: T323S

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102420
Gene: ENSMUSG00000035031
AA Change: T323S

DomainStartEndE-ValueType
Blast:TSP1 4 47 3e-15 BLAST
LDLa 51 88 2.07e-11 SMART
MACPF 244 448 5.26e-58 SMART
Blast:EGF 452 485 4e-13 BLAST
Blast:TSP1 501 543 3e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152146
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the alpha subunit, which associates with the beta and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the beta subunit. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8a2 A C 14: 59,860,323 probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Irf7 T C 7: 141,264,022 T246A probably damaging Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Klhdc8a G A 1: 132,302,647 A167T possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Smtnl1 T A 2: 84,818,436 D158V probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Ubr5 G A 15: 38,014,924 probably benign Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vegfa G A 17: 46,025,492 T56I possibly damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Zmym2 T C 14: 56,943,327 Y899H probably damaging Het
Other mutations in C8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:C8a APN 4 104865445 intron probably benign
IGL01326:C8a APN 4 104856420 missense probably damaging 1.00
IGL01339:C8a APN 4 104827985 missense probably benign 0.00
IGL01809:C8a APN 4 104845942 missense probably benign 0.06
IGL01843:C8a APN 4 104862611 nonsense probably null
IGL01988:C8a APN 4 104826694 missense probably damaging 1.00
IGL02187:C8a APN 4 104862736 missense probably damaging 1.00
IGL02430:C8a APN 4 104817522 missense probably damaging 0.97
IGL02537:C8a APN 4 104845951 missense probably damaging 1.00
derogation UTSW 4 104828078 missense possibly damaging 0.50
insult UTSW 4 104828039 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0367:C8a UTSW 4 104862594 critical splice donor site probably null
R0632:C8a UTSW 4 104856492 missense probably damaging 1.00
R1013:C8a UTSW 4 104828039 missense probably benign 0.00
R1902:C8a UTSW 4 104856601 critical splice acceptor site probably null
R2969:C8a UTSW 4 104853777 missense probably damaging 0.97
R3735:C8a UTSW 4 104817615 missense probably benign 0.43
R3736:C8a UTSW 4 104817615 missense probably benign 0.43
R4245:C8a UTSW 4 104876346 missense probably benign 0.00
R4707:C8a UTSW 4 104856421 missense probably damaging 1.00
R4812:C8a UTSW 4 104862591 splice site probably null
R5221:C8a UTSW 4 104845925 missense probably damaging 1.00
R5279:C8a UTSW 4 104845988 missense probably damaging 1.00
R5461:C8a UTSW 4 104815845 utr 3 prime probably benign
R5881:C8a UTSW 4 104853932 missense probably damaging 0.99
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6191:C8a UTSW 4 104845903 missense probably benign 0.00
R6626:C8a UTSW 4 104845967 missense probably benign 0.01
R7438:C8a UTSW 4 104861429 missense probably damaging 0.97
R7471:C8a UTSW 4 104817625 missense probably benign 0.01
R7514:C8a UTSW 4 104846050 missense possibly damaging 0.94
R7596:C8a UTSW 4 104853867 missense possibly damaging 0.49
X0012:C8a UTSW 4 104826782 missense probably damaging 1.00
X0019:C8a UTSW 4 104817586 missense probably damaging 1.00
Z1176:C8a UTSW 4 104862686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAAATGGAATCCGCTGGAGG -3'
(R):5'- AATCTAGAGCCGCTTGTGCCCATC -3'

Sequencing Primer
(F):5'- ATTGCCCGAATGATGTGTCC -3'
(R):5'- TTGTGCCCATCCCCCAC -3'
Posted On2014-03-14