Mutagenetix > Incidental Mutations

Incidental Mutation 'R1442:Adamts7'

161544

Institutional Source

Beutler Lab

Gene Symbol

Adamts7

Ensembl Gene

ENSMUSG00000032363

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7

Synonyms

ADAM-TS7

MMRRC Submission

039497-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R1442 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90163069-90208071 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90188770 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 648 (I648N)

Ref Sequence

ENSEMBL: ENSMUSP00000108683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]

Predicted Effect

probably damaging
Transcript: ENSMUST00000113059
AA Change: I648N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: I648N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	174	1.1e-36	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.3e-16	PFAM
Pfam:Reprolysin_4	224	425	8.5e-9	PFAM
Pfam:Reprolysin	226	437	2.2e-27	PFAM
Pfam:Reprolysin_2	244	427	2.9e-12	PFAM
Pfam:Reprolysin_3	248	383	5.2e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	2.2e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113060
AA Change: I648N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: I648N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	3.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.6e-16	PFAM
Pfam:Reprolysin_4	224	425	8.2e-9	PFAM
Pfam:Reprolysin	226	437	6.4e-30	PFAM
Pfam:Reprolysin_2	244	427	4.6e-12	PFAM
Pfam:Reprolysin_3	248	383	8.1e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.5e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1343	1393	2.4e-2	SMART
TSP1	1394	1451	1.8e-2	SMART
TSP1	1453	1500	4.82e-2	SMART
TSP1	1501	1558	1.39e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134996

SMART Domains

Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.4e-29	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	412	1e-17	PFAM
Pfam:Reprolysin_4	224	426	5e-10	PFAM
Pfam:Reprolysin	226	437	3.7e-31	PFAM
Pfam:Reprolysin_2	244	427	3.2e-13	PFAM
Pfam:Reprolysin_3	248	383	6.3e-14	PFAM
Blast:ACR	439	505	7e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144943

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147250
AA Change: I648N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: I648N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.7e-26	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.4e-14	PFAM
Pfam:Reprolysin_4	224	425	7e-7	PFAM
Pfam:Reprolysin	226	437	4.9e-28	PFAM
Pfam:Reprolysin_2	244	427	5e-10	PFAM
Pfam:Reprolysin_3	248	383	6.5e-11	PFAM
ACR	439	515	1.7e-5	SMART
TSP1	526	578	2.3e-15	SMART
Pfam:ADAM_spacer1	683	794	3.5e-34	PFAM
TSP1	807	863	6.9e-9	SMART
TSP1	866	908	1.2e-3	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1284	1334	1.2e-4	SMART
TSP1	1335	1392	8.7e-5	SMART
TSP1	1394	1441	2.3e-4	SMART
TSP1	1442	1499	6.5e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167122
AA Change: I648N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: I648N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	1.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	7.2e-17	PFAM
Pfam:Reprolysin_4	224	425	3.6e-9	PFAM
Pfam:Reprolysin	226	437	2.9e-30	PFAM
Pfam:Reprolysin_2	244	427	2.2e-12	PFAM
Pfam:Reprolysin_3	248	383	3.7e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.1e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,955,632		probably benign	Het
Akap13	T	A	7: 75,735,778	F2252I	probably damaging	Het
Akr1c6	A	T	13: 4,457,160	H314L	probably damaging	Het
Anxa3	T	A	5: 96,828,690		probably null	Het
Apob	T	G	12: 7,986,165	F298V	probably benign	Het
Atp8a2	A	C	14: 59,860,323		probably benign	Het
Atp8b5	A	T	4: 43,334,313	T360S	probably damaging	Het
BC051665	A	T	13: 60,784,741	N43K	probably benign	Het
Bicral	T	A	17: 46,801,724	H850L	probably benign	Het
C1qtnf1	A	G	11: 118,448,185	D227G	probably damaging	Het
C8a	T	A	4: 104,828,078	T323S	possibly damaging	Het
Cep89	T	C	7: 35,418,211		probably benign	Het
Cercam	G	T	2: 29,880,640	V408L	probably benign	Het
CN725425	G	A	15: 91,238,955	V76M	possibly damaging	Het
Cops7b	T	A	1: 86,605,113	M231K	probably benign	Het
Cpa2	T	A	6: 30,544,866		probably null	Het
Dab2ip	A	T	2: 35,710,256	I287F	probably damaging	Het
Defb10	A	T	8: 21,858,928	M1L	probably benign	Het
Dscam	C	A	16: 96,608,074	R1883L	possibly damaging	Het
Dsg4	T	A	18: 20,462,660	I640N	possibly damaging	Het
Duox2	G	C	2: 122,281,751	P1318R	probably benign	Het
Dzip3	T	C	16: 48,945,622	D466G	probably benign	Het
E230025N22Rik	T	A	18: 36,691,409		probably null	Het
E2f3	A	G	13: 29,918,669	L80P	probably damaging	Het
Eif2b2	T	C	12: 85,219,586	S9P	probably benign	Het
Etaa1	A	T	11: 17,947,201	D305E	probably benign	Het
Fads6	C	A	11: 115,297,409	R23L	probably benign	Het
Flrt2	T	C	12: 95,780,205	V439A	probably damaging	Het
Galm	A	C	17: 80,145,185	Q184P	probably damaging	Het
Gtse1	C	T	15: 85,860,102		probably benign	Het
Irf7	T	C	7: 141,264,022	T246A	probably damaging	Het
Kif28	A	G	1: 179,705,132	V639A	possibly damaging	Het
Klhdc8a	G	A	1: 132,302,647	A167T	possibly damaging	Het
Lrfn3	T	C	7: 30,360,044	H252R	probably benign	Het
Lzts1	G	T	8: 69,138,986	A170E	probably damaging	Het
Mphosph9	T	A	5: 124,265,398	I856F	possibly damaging	Het
Mroh2a	C	T	1: 88,232,353		probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Myh3	A	G	11: 67,087,277	N392D	possibly damaging	Het
Naalad2	T	C	9: 18,351,032		probably benign	Het
Npc1	T	A	18: 12,195,049	M1068L	probably benign	Het
Nupl1	T	A	14: 60,232,543		probably benign	Het
Olfr1286	A	T	2: 111,420,093	I286N	probably damaging	Het
Olfr285	T	C	15: 98,313,187	Y121C	probably damaging	Het
Olfr906	A	T	9: 38,488,643	I205F	probably benign	Het
Olfr95	T	C	17: 37,211,704	T50A	probably benign	Het
Parp2	T	G	14: 50,819,275		probably null	Het
Ppp4r4	T	C	12: 103,598,245	V9A	probably damaging	Het
Ptprc	T	A	1: 138,072,312	D856V	probably damaging	Het
Ptpru	T	A	4: 131,808,269	T466S	probably benign	Het
Rhob	A	G	12: 8,499,325	V103A	possibly damaging	Het
Sec23ip	A	C	7: 128,776,786	S775R	probably benign	Het
Slit2	T	G	5: 48,238,383	D709E	probably damaging	Het
Smok2b	C	G	17: 13,235,503	I183M	probably damaging	Het
Smtnl1	T	A	2: 84,818,436	D158V	probably damaging	Het
Syne2	T	C	12: 75,946,715	I2087T	probably damaging	Het
Tada1	G	A	1: 166,386,750	R106H	possibly damaging	Het
Tecta	T	A	9: 42,332,482	I2025F	probably damaging	Het
Themis	T	C	10: 28,782,135	V386A	probably damaging	Het
Ubr5	G	A	15: 38,014,924		probably benign	Het
Vcl	T	A	14: 20,983,378	I134N	probably damaging	Het
Vegfa	G	A	17: 46,025,492	T56I	possibly damaging	Het
Vmn2r108	T	A	17: 20,472,361	K78*	probably null	Het
Vmn2r82	A	T	10: 79,379,367	T395S	probably benign	Het
Wbp2nl	T	C	15: 82,314,206	S315P	probably benign	Het
Zfp566	T	C	7: 30,077,919	Y279C	probably damaging	Het
Zmym2	T	C	14: 56,943,327	Y899H	probably damaging	Het

Other mutations in Adamts7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Adamts7	APN	9	90194249	missense	possibly damaging	0.71
IGL00673:Adamts7	APN	9	90193661	missense	possibly damaging	0.78
IGL00902:Adamts7	APN	9	90188794	critical splice donor site	probably null
IGL01303:Adamts7	APN	9	90171734	missense	possibly damaging	0.46
IGL01333:Adamts7	APN	9	90186979	missense	probably damaging	1.00
IGL01431:Adamts7	APN	9	90207785	missense	possibly damaging	0.89
IGL01595:Adamts7	APN	9	90193306	missense	probably benign	0.02
IGL02728:Adamts7	APN	9	90191827	splice site	probably benign
IGL02860:Adamts7	APN	9	90191862	missense	probably benign
IGL03237:Adamts7	APN	9	90188664	missense	probably damaging	1.00
PIT4495001:Adamts7	UTSW	9	90174622	missense	probably damaging	1.00
R0044:Adamts7	UTSW	9	90171588	missense	possibly damaging	0.58
R0078:Adamts7	UTSW	9	90179411	missense	probably damaging	1.00
R0107:Adamts7	UTSW	9	90180720	missense	possibly damaging	0.82
R0122:Adamts7	UTSW	9	90179421	missense	probably damaging	1.00
R0166:Adamts7	UTSW	9	90193692	missense	probably benign	0.00
R0517:Adamts7	UTSW	9	90199858	missense	probably benign	0.01
R1468:Adamts7	UTSW	9	90188798	splice site	probably benign
R1554:Adamts7	UTSW	9	90173650	missense	probably damaging	1.00
R1612:Adamts7	UTSW	9	90188697	missense	possibly damaging	0.86
R1652:Adamts7	UTSW	9	90189644	missense	probably damaging	1.00
R2007:Adamts7	UTSW	9	90177856	missense	probably damaging	1.00
R2091:Adamts7	UTSW	9	90188440	critical splice donor site	probably null
R2202:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2204:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2205:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2305:Adamts7	UTSW	9	90180711	missense	probably benign	0.39
R2409:Adamts7	UTSW	9	90180687	missense	probably damaging	1.00
R4157:Adamts7	UTSW	9	90188361	missense	probably damaging	1.00
R4210:Adamts7	UTSW	9	90194010	missense	possibly damaging	0.95
R4368:Adamts7	UTSW	9	90195851	critical splice donor site	probably null
R4533:Adamts7	UTSW	9	90180708	missense	probably damaging	1.00
R4608:Adamts7	UTSW	9	90174540	missense	probably damaging	1.00
R4623:Adamts7	UTSW	9	90186462	missense	probably benign	0.17
R4661:Adamts7	UTSW	9	90193330	missense	probably benign	0.02
R4820:Adamts7	UTSW	9	90189686	missense	possibly damaging	0.62
R4942:Adamts7	UTSW	9	90163311	missense	probably benign
R4961:Adamts7	UTSW	9	90185740	missense	probably damaging	1.00
R5064:Adamts7	UTSW	9	90195830	missense	probably damaging	1.00
R5763:Adamts7	UTSW	9	90188409	missense	probably damaging	1.00
R5921:Adamts7	UTSW	9	90188694	missense	probably benign	0.20
R6027:Adamts7	UTSW	9	90191025	missense	probably damaging	1.00
R6182:Adamts7	UTSW	9	90192436	missense	probably benign	0.01
R6306:Adamts7	UTSW	9	90178278	critical splice donor site	probably null
R6404:Adamts7	UTSW	9	90180456	intron	probably null
R6488:Adamts7	UTSW	9	90171482	missense	probably benign	0.00
R6649:Adamts7	UTSW	9	90191937	missense	probably damaging	1.00
R6658:Adamts7	UTSW	9	90195300	missense	probably damaging	0.99
R6874:Adamts7	UTSW	9	90188731	missense	probably damaging	1.00
R6947:Adamts7	UTSW	9	90191804	intron	probably null
R7110:Adamts7	UTSW	9	90193964	missense	possibly damaging	0.92
R7224:Adamts7	UTSW	9	90185815	missense	probably damaging	1.00
R7239:Adamts7	UTSW	9	90186557	splice site	probably null
R7519:Adamts7	UTSW	9	90197079	missense	probably benign	0.22
R7608:Adamts7	UTSW	9	90173773	missense	possibly damaging	0.68
R7635:Adamts7	UTSW	9	90195245	missense	probably damaging	1.00
X0028:Adamts7	UTSW	9	90178217	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TGTGCCCAATGACGGTGAGTTATG -3'
(R):5'- TGCTAACTGTGGGCTCTCCATTGC -3'

Sequencing Primer
(F):5'- AATGACGGTGAGTTATGCTACCC -3'
(R):5'- GCTCTCCATTGCCAGAGACAG -3'

Posted On

2014-03-14