Incidental Mutation 'R1442:Zmym2'
ID161562
Institutional Source Beutler Lab
Gene Symbol Zmym2
Ensembl Gene ENSMUSG00000021945
Gene Namezinc finger, MYM-type 2
SynonymsRAMP, FIM, MYM, Zfp198, SCLL
MMRRC Submission 039497-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R1442 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56886653-56962701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56943327 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 899 (Y899H)
Ref Sequence ENSEMBL: ENSMUSP00000022511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022511]
Predicted Effect probably damaging
Transcript: ENSMUST00000022511
AA Change: Y899H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022511
Gene: ENSMUSG00000021945
AA Change: Y899H

DomainStartEndE-ValueType
TRASH 330 366 1.55e-5 SMART
TRASH 372 412 7.69e-1 SMART
TRASH 424 459 7.5e1 SMART
TRASH 466 505 6.53e-4 SMART
Pfam:zf-FCS 527 569 1.8e-9 PFAM
TRASH 583 619 4.79e1 SMART
TRASH 638 674 8.49e-3 SMART
TRASH 680 715 7.28e-2 SMART
TRASH 726 761 1.95e-2 SMART
TRASH 767 802 3.89e1 SMART
low complexity region 881 895 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
Pfam:DUF3504 1191 1359 7.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225393
Meta Mutation Damage Score 0.2126 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a protein that contains nine MYM-type zinc finger motifs. Expression of this gene may mediate the inhibition of hematopoietic cell development during ontogeny, and the encoded protein may also play a role in transforming growth factor-beta signaling as a Smad binding protein. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8a2 A C 14: 59,860,323 probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
C8a T A 4: 104,828,078 T323S possibly damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Irf7 T C 7: 141,264,022 T246A probably damaging Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Klhdc8a G A 1: 132,302,647 A167T possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Smtnl1 T A 2: 84,818,436 D158V probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Ubr5 G A 15: 38,014,924 probably benign Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vegfa G A 17: 46,025,492 T56I possibly damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Other mutations in Zmym2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Zmym2 APN 14 56947937 splice site probably benign
IGL00587:Zmym2 APN 14 56903360 missense possibly damaging 0.86
IGL00736:Zmym2 APN 14 56903211 missense probably benign 0.01
IGL00753:Zmym2 APN 14 56957060 nonsense probably null
IGL01608:Zmym2 APN 14 56948015 missense possibly damaging 0.57
IGL01744:Zmym2 APN 14 56946572 missense probably benign 0.24
IGL02150:Zmym2 APN 14 56911069 splice site probably benign
IGL02186:Zmym2 APN 14 56943351 missense probably benign 0.09
IGL02654:Zmym2 APN 14 56911315 missense probably damaging 1.00
IGL02960:Zmym2 APN 14 56938413 missense probably benign 0.09
IGL03104:Zmym2 APN 14 56950327 missense possibly damaging 0.88
IGL03162:Zmym2 APN 14 56914043 missense probably benign 0.24
IGL03356:Zmym2 APN 14 56957060 nonsense probably null
IGL03412:Zmym2 APN 14 56959719 nonsense probably null
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0132:Zmym2 UTSW 14 56943258 missense probably benign
R0270:Zmym2 UTSW 14 56949684 splice site probably null
R0834:Zmym2 UTSW 14 56956963 missense probably damaging 1.00
R1071:Zmym2 UTSW 14 56959821 missense possibly damaging 0.93
R1386:Zmym2 UTSW 14 56913091 missense probably damaging 1.00
R1472:Zmym2 UTSW 14 56911183 missense probably benign 0.20
R1595:Zmym2 UTSW 14 56920730 missense probably benign 0.25
R1598:Zmym2 UTSW 14 56902769 missense possibly damaging 0.94
R1598:Zmym2 UTSW 14 56914067 missense probably damaging 1.00
R1916:Zmym2 UTSW 14 56959842 missense probably damaging 1.00
R2261:Zmym2 UTSW 14 56928262 missense probably damaging 1.00
R2393:Zmym2 UTSW 14 56920723 missense probably benign 0.17
R2866:Zmym2 UTSW 14 56928248 missense probably damaging 1.00
R3727:Zmym2 UTSW 14 56919349 splice site probably benign
R3847:Zmym2 UTSW 14 56921499 splice site probably benign
R4043:Zmym2 UTSW 14 56958308 splice site probably benign
R4074:Zmym2 UTSW 14 56903004 missense probably damaging 0.99
R4343:Zmym2 UTSW 14 56921562 missense probably damaging 0.99
R4420:Zmym2 UTSW 14 56956878 missense probably damaging 0.98
R4645:Zmym2 UTSW 14 56928307 missense probably damaging 1.00
R5015:Zmym2 UTSW 14 56921594 missense probably damaging 1.00
R5038:Zmym2 UTSW 14 56956180 missense possibly damaging 0.86
R5223:Zmym2 UTSW 14 56946514 missense probably benign
R5364:Zmym2 UTSW 14 56920645 missense possibly damaging 0.58
R5488:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5489:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5818:Zmym2 UTSW 14 56946529 missense probably benign
R6160:Zmym2 UTSW 14 56950309 missense probably damaging 1.00
R6437:Zmym2 UTSW 14 56903004 missense probably damaging 1.00
R7107:Zmym2 UTSW 14 56902712 missense probably benign 0.01
R7153:Zmym2 UTSW 14 56950202 missense probably benign 0.16
R7337:Zmym2 UTSW 14 56944100 missense probably benign 0.04
R7535:Zmym2 UTSW 14 56957079 missense probably damaging 1.00
R7730:Zmym2 UTSW 14 56956181 missense possibly damaging 0.95
R7779:Zmym2 UTSW 14 56928283 missense probably damaging 1.00
R7849:Zmym2 UTSW 14 56946563 missense probably benign 0.03
R7932:Zmym2 UTSW 14 56946563 missense probably benign 0.03
Z1176:Zmym2 UTSW 14 56912999 missense possibly damaging 0.94
Z1177:Zmym2 UTSW 14 56913962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGACTATTGTGCAGCTCAATGTTT -3'
(R):5'- GCATTAAATCCACTTTGTCACAGCAACT -3'

Sequencing Primer
(F):5'- agacagaagcagaggcatc -3'
(R):5'- GCAACTATAATTAGTACAGCTTTGCC -3'
Posted On2014-03-14