Incidental Mutation 'R1442:Atp8a2'
ID161563
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission 039497-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1442 (G1)
Quality Score185
Status Validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 59860323 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably benign
Transcript: ENSMUST00000080368
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
C8a T A 4: 104,828,078 T323S possibly damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Irf7 T C 7: 141,264,022 T246A probably damaging Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Klhdc8a G A 1: 132,302,647 A167T possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Smtnl1 T A 2: 84,818,436 D158V probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Ubr5 G A 15: 38,014,924 probably benign Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vegfa G A 17: 46,025,492 T56I possibly damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Zmym2 T C 14: 56,943,327 Y899H probably damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 splice site probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
R8116:Atp8a2 UTSW 14 60026208 missense probably damaging 1.00
R8171:Atp8a2 UTSW 14 60046044 missense probably damaging 1.00
R8504:Atp8a2 UTSW 14 59647917 nonsense probably null
R8516:Atp8a2 UTSW 14 59691472 missense probably benign 0.00
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Z1177:Atp8a2 UTSW 14 60006330 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TAGATGGTGGCTTCCCAAGGTAGG -3'
(R):5'- ATCCCACACAGCAGTGGATAGCAG -3'

Sequencing Primer
(F):5'- ACCTGTGCGATGGCATAATC -3'
(R):5'- ATAGCAGACTGGCTGCTTC -3'
Posted On2014-03-14