Incidental Mutation 'R1442:Vegfa'
ID161575
Institutional Source Beutler Lab
Gene Symbol Vegfa
Ensembl Gene ENSMUSG00000023951
Gene Namevascular endothelial growth factor A
SynonymsVEGF-A, VPF, VEGF164, VEGF120, VEGF188, Vegf
MMRRC Submission 039497-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1442 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46016993-46032369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46025492 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 56 (T56I)
Ref Sequence ENSEMBL: ENSMUSP00000109147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024747] [ENSMUST00000071648] [ENSMUST00000113519] [ENSMUST00000113520] [ENSMUST00000142351] [ENSMUST00000167860] [ENSMUST00000214739] [ENSMUST00000217017]
Predicted Effect probably benign
Transcript: ENSMUST00000024747
AA Change: T56I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024747
Gene: ENSMUSG00000023951
AA Change: T56I

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000071648
AA Change: T234I

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071575
Gene: ENSMUSG00000023951
AA Change: T234I

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 312 368 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113519
AA Change: T56I

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109147
Gene: ENSMUSG00000023951
AA Change: T56I

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
low complexity region 140 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113520
AA Change: T56I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109148
Gene: ENSMUSG00000023951
AA Change: T56I

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Pfam:VEGF_C 154 208 9.5e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142321
Predicted Effect possibly damaging
Transcript: ENSMUST00000142351
AA Change: T234I

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115883
Gene: ENSMUSG00000023951
AA Change: T234I

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 339 392 1.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150327
Predicted Effect probably benign
Transcript: ENSMUST00000167860
AA Change: T234I

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131901
Gene: ENSMUSG00000023951
AA Change: T234I

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214739
AA Change: T234I

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217017
AA Change: T234I

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.[provided by RefSeq, Nov 2015]
PHENOTYPE: Hetero- or homozygous null mutants show embryonic lethality with impaired angiogenesis and blood-island formation. Mutants selectively expressing isoform 120 or 188 exhibit vascular outgrowth/patterning defects or impaired arterial development, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8a2 A C 14: 59,860,323 probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
C8a T A 4: 104,828,078 T323S possibly damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Irf7 T C 7: 141,264,022 T246A probably damaging Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Klhdc8a G A 1: 132,302,647 A167T possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Smtnl1 T A 2: 84,818,436 D158V probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Ubr5 G A 15: 38,014,924 probably benign Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Zmym2 T C 14: 56,943,327 Y899H probably damaging Het
Other mutations in Vegfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Vegfa APN 17 46025421 missense possibly damaging 0.88
IGL02859:Vegfa APN 17 46024495 missense probably benign 0.43
R1760:Vegfa UTSW 17 46025469 missense probably damaging 1.00
R1982:Vegfa UTSW 17 46018860 makesense probably null
R2012:Vegfa UTSW 17 46025358 missense probably benign 0.21
R3729:Vegfa UTSW 17 46024520 missense possibly damaging 0.80
R4276:Vegfa UTSW 17 46031466 missense probably benign
R4277:Vegfa UTSW 17 46031466 missense probably benign
R4279:Vegfa UTSW 17 46031466 missense probably benign
R4654:Vegfa UTSW 17 46025250 intron probably benign
R4696:Vegfa UTSW 17 46028346 splice site probably null
R7798:Vegfa UTSW 17 46031835 missense probably damaging 1.00
R7863:Vegfa UTSW 17 46025535 missense probably damaging 1.00
R7946:Vegfa UTSW 17 46025535 missense probably damaging 1.00
X0026:Vegfa UTSW 17 46025526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCCAGACAACCTTCTAATGC -3'
(R):5'- TGTACCCAGACTCAGGCTGTCATC -3'

Sequencing Primer
(F):5'- GACAACCTTCTAATGCCCCTC -3'
(R):5'- ACTCAGGCTGTCATCTGGAG -3'
Posted On2014-03-14