Mutagenetix > Incidental Mutation

Incidental Mutation 'R1442:Dsg4'

161579

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

039497-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R1442 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20462660 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 640 (I640N)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019426
AA Change: I640N

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: I640N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,955,632		probably benign	Het
Adamts7	T	A	9: 90,188,770	I648N	probably damaging	Het
Akap13	T	A	7: 75,735,778	F2252I	probably damaging	Het
Akr1c6	A	T	13: 4,457,160	H314L	probably damaging	Het
Anxa3	T	A	5: 96,828,690		probably null	Het
Apob	T	G	12: 7,986,165	F298V	probably benign	Het
Atp8a2	A	C	14: 59,860,323		probably benign	Het
Atp8b5	A	T	4: 43,334,313	T360S	probably damaging	Het
BC051665	A	T	13: 60,784,741	N43K	probably benign	Het
Bicral	T	A	17: 46,801,724	H850L	probably benign	Het
C1qtnf1	A	G	11: 118,448,185	D227G	probably damaging	Het
C8a	T	A	4: 104,828,078	T323S	possibly damaging	Het
Cep89	T	C	7: 35,418,211		probably benign	Het
Cercam	G	T	2: 29,880,640	V408L	probably benign	Het
CN725425	G	A	15: 91,238,955	V76M	possibly damaging	Het
Cops7b	T	A	1: 86,605,113	M231K	probably benign	Het
Cpa2	T	A	6: 30,544,866		probably null	Het
Dab2ip	A	T	2: 35,710,256	I287F	probably damaging	Het
Defb10	A	T	8: 21,858,928	M1L	probably benign	Het
Dscam	C	A	16: 96,608,074	R1883L	possibly damaging	Het
Duox2	G	C	2: 122,281,751	P1318R	probably benign	Het
Dzip3	T	C	16: 48,945,622	D466G	probably benign	Het
E230025N22Rik	T	A	18: 36,691,409		probably null	Het
E2f3	A	G	13: 29,918,669	L80P	probably damaging	Het
Eif2b2	T	C	12: 85,219,586	S9P	probably benign	Het
Etaa1	A	T	11: 17,947,201	D305E	probably benign	Het
Fads6	C	A	11: 115,297,409	R23L	probably benign	Het
Flrt2	T	C	12: 95,780,205	V439A	probably damaging	Het
Galm	A	C	17: 80,145,185	Q184P	probably damaging	Het
Gtse1	C	T	15: 85,860,102		probably benign	Het
Irf7	T	C	7: 141,264,022	T246A	probably damaging	Het
Kif28	A	G	1: 179,705,132	V639A	possibly damaging	Het
Klhdc8a	G	A	1: 132,302,647	A167T	possibly damaging	Het
Lrfn3	T	C	7: 30,360,044	H252R	probably benign	Het
Lzts1	G	T	8: 69,138,986	A170E	probably damaging	Het
Mphosph9	T	A	5: 124,265,398	I856F	possibly damaging	Het
Mroh2a	C	T	1: 88,232,353		probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Myh3	A	G	11: 67,087,277	N392D	possibly damaging	Het
Naalad2	T	C	9: 18,351,032		probably benign	Het
Npc1	T	A	18: 12,195,049	M1068L	probably benign	Het
Nupl1	T	A	14: 60,232,543		probably benign	Het
Olfr1286	A	T	2: 111,420,093	I286N	probably damaging	Het
Olfr285	T	C	15: 98,313,187	Y121C	probably damaging	Het
Olfr906	A	T	9: 38,488,643	I205F	probably benign	Het
Olfr95	T	C	17: 37,211,704	T50A	probably benign	Het
Parp2	T	G	14: 50,819,275		probably null	Het
Ppp4r4	T	C	12: 103,598,245	V9A	probably damaging	Het
Ptprc	T	A	1: 138,072,312	D856V	probably damaging	Het
Ptpru	T	A	4: 131,808,269	T466S	probably benign	Het
Rhob	A	G	12: 8,499,325	V103A	possibly damaging	Het
Sec23ip	A	C	7: 128,776,786	S775R	probably benign	Het
Slit2	T	G	5: 48,238,383	D709E	probably damaging	Het
Smok2b	C	G	17: 13,235,503	I183M	probably damaging	Het
Smtnl1	T	A	2: 84,818,436	D158V	probably damaging	Het
Syne2	T	C	12: 75,946,715	I2087T	probably damaging	Het
Tada1	G	A	1: 166,386,750	R106H	possibly damaging	Het
Tecta	T	A	9: 42,332,482	I2025F	probably damaging	Het
Themis	T	C	10: 28,782,135	V386A	probably damaging	Het
Ubr5	G	A	15: 38,014,924		probably benign	Het
Vcl	T	A	14: 20,983,378	I134N	probably damaging	Het
Vegfa	G	A	17: 46,025,492	T56I	possibly damaging	Het
Vmn2r108	T	A	17: 20,472,361	K78*	probably null	Het
Vmn2r82	A	T	10: 79,379,367	T395S	probably benign	Het
Wbp2nl	T	C	15: 82,314,206	S315P	probably benign	Het
Zfp566	T	C	7: 30,077,919	Y279C	probably damaging	Het
Zmym2	T	C	14: 56,943,327	Y899H	probably damaging	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
woodshed	UTSW	18	20451872	nonsense	probably null
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62
R9508:Dsg4	UTSW	18	20471013	missense	probably damaging	1.00
R9607:Dsg4	UTSW	18	20452990	missense	probably benign	0.00
R9765:Dsg4	UTSW	18	20471277	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACCACCATGTGTGCTTGCACTC -3'
(R):5'- TGTTGACGCTCAAGACTTAGCCC -3'

Sequencing Primer
(F):5'- TTGCACTCCAGTACCACGG -3'
(R):5'- AGGGCCTCTTTTAAATCCAGG -3'

Posted On

2014-03-14