Mutagenetix > Incidental Mutation

Incidental Mutation 'R1453:Focad'

161592

Institutional Source

Beutler Lab

Gene Symbol

Focad

Ensembl Gene

ENSMUSG00000038368

Gene Name

focadhesin

Synonyms

BC057079

MMRRC Submission

039508-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.511) question?

Stock #

R1453 (G1)

Quality Score

135

Status

Not validated

Chromosome

Chromosomal Location

88094629-88411011 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 88357442 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000097992] [ENSMUST00000159342]

AlphaFold

A2AKG8

Predicted Effect

probably null
Transcript: ENSMUST00000097992

SMART Domains

Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368

Domain	Start	End	E-Value	Type
low complexity region	150	161	N/A	INTRINSIC
low complexity region	194	203	N/A	INTRINSIC
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	490	714	1.5e-71	PFAM
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1200	1209	N/A	INTRINSIC
Pfam:DUF3028	1210	1798	1.5e-291	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000097992

SMART Domains

Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368

Domain	Start	End	E-Value	Type
low complexity region	150	161	N/A	INTRINSIC
low complexity region	194	203	N/A	INTRINSIC
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	490	714	1.5e-71	PFAM
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1200	1209	N/A	INTRINSIC
Pfam:DUF3028	1210	1798	1.5e-291	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107148

Predicted Effect

probably null
Transcript: ENSMUST00000159342

SMART Domains

Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368

Domain	Start	End	E-Value	Type
Pfam:DUF3730	20	250	5.8e-27	PFAM
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	403	633	2.8e-61	PFAM
low complexity region	871	883	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1114	1123	N/A	INTRINSIC
Pfam:DUF3028	1124	1712	N/A	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430105I19Rik	T	C	2: 118,757,422	D477G	possibly damaging	Het
Abca4	A	G	3: 122,069,114	I240M	probably benign	Het
Abcd3	A	T	3: 121,765,061	D595E	probably damaging	Het
Akap9	A	G	5: 3,975,614		probably null	Het
Arpc1b	A	G	5: 145,125,745	D223G	probably damaging	Het
Atp6ap1l	T	A	13: 90,898,747	T104S	probably benign	Het
BC005537	T	C	13: 24,805,986		probably null	Het
Chrdl2	T	C	7: 100,016,990	V39A	possibly damaging	Het
Clmp	C	G	9: 40,782,441	S318W	probably damaging	Het
Cmas	T	C	6: 142,772,127	S323P	probably damaging	Het
Cnksr3	T	C	10: 7,129,132	T80A	probably benign	Het
Ddx25	T	C	9: 35,542,002	Y484C	probably damaging	Het
Dennd6b	A	G	15: 89,188,872	V154A	probably damaging	Het
Dmxl1	G	A	18: 49,857,249	V252I	probably benign	Het
Dnah2	T	C	11: 69,451,050	Y3003C	probably damaging	Het
Dnhd1	T	C	7: 105,721,273		probably null	Het
Dppa4	G	A	16: 48,291,233	A194T	probably damaging	Het
Dst	T	C	1: 34,189,446	V2218A	possibly damaging	Het
Dytn	G	C	1: 63,633,873	S457C	probably damaging	Het
Fndc3a	G	A	14: 72,540,328	Q1101*	probably null	Het
Gas2l2	T	A	11: 83,422,081	T802S	probably benign	Het
Gm5093	A	G	17: 46,439,696	F135S	probably benign	Het
Gmeb1	A	T	4: 132,242,448	D71E	possibly damaging	Het
Heatr5b	G	A	17: 78,817,563	R587C	probably damaging	Het
Hrasls5	A	G	19: 7,639,634		probably benign	Het
Jakmip2	T	C	18: 43,559,214		probably null	Het
Mier3	T	A	13: 111,705,244	L111Q	probably damaging	Het
Mrgprg	G	A	7: 143,765,042	S111F	possibly damaging	Het
Mybl1	T	C	1: 9,671,676	K677R	probably benign	Het
Nhsl1	T	C	10: 18,531,575	S1486P	probably damaging	Het
Nup133	A	G	8: 123,915,375	I783T	probably benign	Het
Olfr262	A	T	19: 12,241,592	I23K	probably benign	Het
Olfr961	A	T	9: 39,647,163	T146S	probably benign	Het
Pigr	A	T	1: 130,841,544	I31L	probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Pramel6	T	A	2: 87,508,573	M39K	possibly damaging	Het
Rapgef6	T	A	11: 54,639,727		probably null	Het
Rinl	T	C	7: 28,796,904	C437R	probably damaging	Het
Shank1	T	C	7: 44,316,075	S192P	unknown	Het
Slc2a10	A	T	2: 165,517,650	Y478F	probably damaging	Het
Slc37a3	A	T	6: 39,366,943	L12H	probably damaging	Het
Slit2	T	A	5: 48,257,051	C970S	possibly damaging	Het
Stard9	T	C	2: 120,666,376	S119P	probably damaging	Het
Stim2	C	A	5: 54,116,109	D568E	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Traf3	A	G	12: 111,255,323	E306G	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll6	T	C	11: 96,158,888	S811P	possibly damaging	Het
Ubr7	A	G	12: 102,769,178	K299E	probably benign	Het
Urb1	C	A	16: 90,796,492	V251L	probably damaging	Het
Vps13b	G	T	15: 35,422,444	E183D	probably damaging	Het
Zfp35	T	G	18: 24,003,500	Y300*	probably null	Het
Zfp414	C	T	17: 33,630,038	T33I	probably damaging	Het
Zfp938	C	T	10: 82,227,798		probably null	Het

Other mutations in Focad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Focad	APN	4	88357474	missense	unknown
IGL00562:Focad	APN	4	88348809	missense	unknown
IGL00563:Focad	APN	4	88348809	missense	unknown
IGL00900:Focad	APN	4	88129023	missense	probably damaging	0.99
IGL00984:Focad	APN	4	88344785	missense	unknown
IGL01016:Focad	APN	4	88392015	missense	possibly damaging	0.51
IGL01069:Focad	APN	4	88326146	missense	unknown
IGL01305:Focad	APN	4	88393547	missense	probably benign	0.32
IGL01409:Focad	APN	4	88342305	missense	unknown
IGL01447:Focad	APN	4	88326228	missense	unknown
IGL01521:Focad	APN	4	88410690	makesense	probably null
IGL01672:Focad	APN	4	88360590	critical splice donor site	probably null
IGL01739:Focad	APN	4	88370806	missense	unknown
IGL02082:Focad	APN	4	88230578	nonsense	probably null
IGL02139:Focad	APN	4	88129054	critical splice donor site	probably null
IGL02381:Focad	APN	4	88274090	splice site	probably benign
IGL02898:Focad	APN	4	88391997	missense	probably benign	0.02
certitude	UTSW	4	88178133	missense	probably damaging	1.00
impression	UTSW	4	88278242	missense	unknown
Microscope	UTSW	4	88342204	missense	unknown
Nuance	UTSW	4	88196846	intron	probably benign
Objective	UTSW	4	88401068	nonsense	probably null
ANU22:Focad	UTSW	4	88393547	missense	probably benign	0.32
R0025:Focad	UTSW	4	88408959	missense	probably benign	0.02
R0554:Focad	UTSW	4	88348889	missense	unknown
R0617:Focad	UTSW	4	88121288	unclassified	probably benign
R0688:Focad	UTSW	4	88274213	missense	unknown
R0746:Focad	UTSW	4	88397214	missense	possibly damaging	0.84
R0907:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1109:Focad	UTSW	4	88196747	intron	probably benign
R1136:Focad	UTSW	4	88326180	missense	unknown
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1412:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1697:Focad	UTSW	4	88408988	missense	probably damaging	0.98
R1739:Focad	UTSW	4	88397891	missense	probably benign	0.05
R1767:Focad	UTSW	4	88357468	missense	unknown
R1827:Focad	UTSW	4	88229383	missense	probably benign	0.03
R1866:Focad	UTSW	4	88407165	missense	possibly damaging	0.92
R1867:Focad	UTSW	4	88178089	missense	probably damaging	0.99
R1929:Focad	UTSW	4	88342212	missense	unknown
R1929:Focad	UTSW	4	88397179	missense	probably benign	0.32
R1937:Focad	UTSW	4	88401081	start codon destroyed	probably null
R1989:Focad	UTSW	4	88232784	critical splice donor site	probably null
R2176:Focad	UTSW	4	88279244	missense	unknown
R2393:Focad	UTSW	4	88121330	missense	probably damaging	0.96
R2431:Focad	UTSW	4	88331027	missense	unknown
R3195:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3196:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3730:Focad	UTSW	4	88408925	missense	possibly damaging	0.52
R3772:Focad	UTSW	4	88336161	splice site	probably benign
R4391:Focad	UTSW	4	88185958	missense	probably damaging	1.00
R4491:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4492:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4703:Focad	UTSW	4	88342321	critical splice donor site	probably null
R4788:Focad	UTSW	4	88357469	missense	unknown
R4923:Focad	UTSW	4	88196846	intron	probably benign
R5026:Focad	UTSW	4	88344582	missense	unknown
R5122:Focad	UTSW	4	88407365	critical splice donor site	probably null
R5153:Focad	UTSW	4	88359884	missense	unknown
R5369:Focad	UTSW	4	88121373	splice site	probably benign
R5414:Focad	UTSW	4	88410702	utr 3 prime	probably benign
R5839:Focad	UTSW	4	88196846	intron	probably benign
R5916:Focad	UTSW	4	88357541	missense	unknown
R5953:Focad	UTSW	4	88229335	missense	probably benign	0.01
R5991:Focad	UTSW	4	88401019	missense	possibly damaging	0.91
R6230:Focad	UTSW	4	88342204	missense	unknown
R6247:Focad	UTSW	4	88407140	missense	possibly damaging	0.92
R6324:Focad	UTSW	4	88401068	nonsense	probably null
R6543:Focad	UTSW	4	88279256	missense	unknown
R6639:Focad	UTSW	4	88278242	missense	unknown
R6802:Focad	UTSW	4	88274203	missense	unknown
R6802:Focad	UTSW	4	88344684	missense	unknown
R6866:Focad	UTSW	4	88403386	missense	probably benign	0.34
R6902:Focad	UTSW	4	88230476	missense	unknown
R6928:Focad	UTSW	4	88348875	missense	unknown
R7036:Focad	UTSW	4	88124637	missense	probably benign	0.05
R7057:Focad	UTSW	4	88274105	missense	unknown
R7077:Focad	UTSW	4	88410677	missense	unknown
R7242:Focad	UTSW	4	88309906	missense	unknown
R7357:Focad	UTSW	4	88229335	missense	probably benign	0.19
R7380:Focad	UTSW	4	88274198	missense	unknown
R7427:Focad	UTSW	4	88368751	missense	unknown
R7582:Focad	UTSW	4	88229378	missense	probably benign	0.00
R7661:Focad	UTSW	4	88303535	missense	unknown
R7688:Focad	UTSW	4	88178133	missense	probably damaging	1.00
R7789:Focad	UTSW	4	88229406	missense	unknown
R7880:Focad	UTSW	4	88401170	missense	unknown
R7887:Focad	UTSW	4	88182616	missense	probably damaging	1.00
R8024:Focad	UTSW	4	88397000	missense	unknown
R8129:Focad	UTSW	4	88232763	missense	unknown
R8369:Focad	UTSW	4	88232668	missense	unknown
R8837:Focad	UTSW	4	88154668	missense	probably damaging	0.96
R9014:Focad	UTSW	4	88357526	missense	unknown
R9282:Focad	UTSW	4	88196822	missense	unknown
R9431:Focad	UTSW	4	88403346	missense	unknown
R9435:Focad	UTSW	4	88348839	missense	unknown
R9676:Focad	UTSW	4	88355445	missense	unknown
X0035:Focad	UTSW	4	88397922	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TGCACTTGAACCTCCAAATCCTAGC -3'
(R):5'- TCCATCCCAGGAAGTGAGTCAGAC -3'

Sequencing Primer
(F):5'- tgaacCTCCAAATCCTAGCTAAGATG -3'
(R):5'- AAGTGAGTCAGACAGCAGC -3'

Posted On

2014-03-14