Incidental Mutation 'R1453:Gmeb1'
ID161593
Institutional Source Beutler Lab
Gene Symbol Gmeb1
Ensembl Gene ENSMUSG00000028901
Gene Nameglucocorticoid modulatory element binding protein 1
Synonyms1110050A04Rik
MMRRC Submission 039508-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R1453 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location132221025-132261602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132242448 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 71 (D71E)
Ref Sequence ENSEMBL: ENSMUSP00000131331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030733] [ENSMUST00000105964] [ENSMUST00000105965] [ENSMUST00000168553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030733
AA Change: D71E

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030733
Gene: ENSMUSG00000028901
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105964
AA Change: D71E

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101584
Gene: ENSMUSG00000028901
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105965
AA Change: D71E

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101585
Gene: ENSMUSG00000028901
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125534
Predicted Effect possibly damaging
Transcript: ENSMUST00000168553
AA Change: D71E

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131331
Gene: ENSMUSG00000028901
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of KDWK gene family which associates with GMEB2 protein. The GMEB1-GMEB2 complex is essential for parvovirus DNA replication. Studies in rat for a similar gene suggest that this gene's role is to modulate the transactivation of the glucocorticoid receptor when it is bound to glucocorticoid response elements. Three alternative spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,422 D477G possibly damaging Het
Abca4 A G 3: 122,069,114 I240M probably benign Het
Abcd3 A T 3: 121,765,061 D595E probably damaging Het
Akap9 A G 5: 3,975,614 probably null Het
Arpc1b A G 5: 145,125,745 D223G probably damaging Het
Atp6ap1l T A 13: 90,898,747 T104S probably benign Het
BC005537 T C 13: 24,805,986 probably null Het
Chrdl2 T C 7: 100,016,990 V39A possibly damaging Het
Clmp C G 9: 40,782,441 S318W probably damaging Het
Cmas T C 6: 142,772,127 S323P probably damaging Het
Cnksr3 T C 10: 7,129,132 T80A probably benign Het
Ddx25 T C 9: 35,542,002 Y484C probably damaging Het
Dennd6b A G 15: 89,188,872 V154A probably damaging Het
Dmxl1 G A 18: 49,857,249 V252I probably benign Het
Dnah2 T C 11: 69,451,050 Y3003C probably damaging Het
Dnhd1 T C 7: 105,721,273 probably null Het
Dppa4 G A 16: 48,291,233 A194T probably damaging Het
Dst T C 1: 34,189,446 V2218A possibly damaging Het
Dytn G C 1: 63,633,873 S457C probably damaging Het
Fndc3a G A 14: 72,540,328 Q1101* probably null Het
Focad A T 4: 88,357,442 probably null Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gm5093 A G 17: 46,439,696 F135S probably benign Het
Heatr5b G A 17: 78,817,563 R587C probably damaging Het
Hrasls5 A G 19: 7,639,634 probably benign Het
Jakmip2 T C 18: 43,559,214 probably null Het
Mier3 T A 13: 111,705,244 L111Q probably damaging Het
Mrgprg G A 7: 143,765,042 S111F possibly damaging Het
Mybl1 T C 1: 9,671,676 K677R probably benign Het
Nhsl1 T C 10: 18,531,575 S1486P probably damaging Het
Nup133 A G 8: 123,915,375 I783T probably benign Het
Olfr262 A T 19: 12,241,592 I23K probably benign Het
Olfr961 A T 9: 39,647,163 T146S probably benign Het
Pigr A T 1: 130,841,544 I31L probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel6 T A 2: 87,508,573 M39K possibly damaging Het
Rapgef6 T A 11: 54,639,727 probably null Het
Rinl T C 7: 28,796,904 C437R probably damaging Het
Shank1 T C 7: 44,316,075 S192P unknown Het
Slc2a10 A T 2: 165,517,650 Y478F probably damaging Het
Slc37a3 A T 6: 39,366,943 L12H probably damaging Het
Slit2 T A 5: 48,257,051 C970S possibly damaging Het
Stard9 T C 2: 120,666,376 S119P probably damaging Het
Stim2 C A 5: 54,116,109 D568E probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf3 A G 12: 111,255,323 E306G probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll6 T C 11: 96,158,888 S811P possibly damaging Het
Ubr7 A G 12: 102,769,178 K299E probably benign Het
Urb1 C A 16: 90,796,492 V251L probably damaging Het
Vps13b G T 15: 35,422,444 E183D probably damaging Het
Zfp35 T G 18: 24,003,500 Y300* probably null Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp938 C T 10: 82,227,798 probably null Het
Other mutations in Gmeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Gmeb1 APN 4 132227985 missense probably benign 0.00
IGL02089:Gmeb1 APN 4 132225836 missense probably damaging 1.00
R0137:Gmeb1 UTSW 4 132232108 missense probably benign 0.01
R0326:Gmeb1 UTSW 4 132242352 missense probably damaging 0.98
R0611:Gmeb1 UTSW 4 132226075 nonsense probably null
R0898:Gmeb1 UTSW 4 132234782 missense probably benign 0.01
R1317:Gmeb1 UTSW 4 132234887 nonsense probably null
R1573:Gmeb1 UTSW 4 132251740 missense probably benign 0.12
R1751:Gmeb1 UTSW 4 132234887 nonsense probably null
R1754:Gmeb1 UTSW 4 132232027 missense probably benign
R1761:Gmeb1 UTSW 4 132234887 nonsense probably null
R5203:Gmeb1 UTSW 4 132232009 splice site probably null
R6241:Gmeb1 UTSW 4 132242377 missense possibly damaging 0.64
R6241:Gmeb1 UTSW 4 132246013 missense probably benign 0.00
R7103:Gmeb1 UTSW 4 132234868 missense probably damaging 0.99
R7192:Gmeb1 UTSW 4 132227890 missense probably benign 0.03
R7401:Gmeb1 UTSW 4 132225774 missense probably damaging 0.97
R7528:Gmeb1 UTSW 4 132232050 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGCCCTCGCCTGGGATGCTG -3'
(R):5'- AGTTCCCTGTTGGTGCTGGGGATATA -3'

Sequencing Primer
(F):5'- GGATGCTGAGACCCTGAATC -3'
(R):5'- ACCAACCCATGGTCTGAAAG -3'
Posted On2014-03-14