Incidental Mutation 'R1453:Slc37a3'
ID161600
Institutional Source Beutler Lab
Gene Symbol Slc37a3
Ensembl Gene ENSMUSG00000029924
Gene Namesolute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms
MMRRC Submission 039508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1453 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39334773-39377675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39366943 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 12 (L12H)
Ref Sequence ENSEMBL: ENSMUSP00000144636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090243] [ENSMUST00000200771] [ENSMUST00000200961] [ENSMUST00000200969] [ENSMUST00000201448] [ENSMUST00000202204] [ENSMUST00000202400] [ENSMUST00000202749] [ENSMUST00000202952]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090243
AA Change: L12H

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087709
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
Pfam:MFS_1 23 420 3.8e-37 PFAM
Pfam:Sugar_tr 27 262 2.5e-8 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200771
AA Change: L12H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143953
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200961
AA Change: L12H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144562
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200969
AA Change: L12H

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144244
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201448
AA Change: L12H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144059
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202204
AA Change: L12H

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144316
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202400
AA Change: L12H

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144557
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
Pfam:MFS_1 12 173 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202749
AA Change: L12H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144636
Gene: ENSMUSG00000029924
AA Change: L12H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202928
Predicted Effect probably damaging
Transcript: ENSMUST00000202952
AA Change: L12H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,422 D477G possibly damaging Het
Abca4 A G 3: 122,069,114 I240M probably benign Het
Abcd3 A T 3: 121,765,061 D595E probably damaging Het
Akap9 A G 5: 3,975,614 probably null Het
Arpc1b A G 5: 145,125,745 D223G probably damaging Het
Atp6ap1l T A 13: 90,898,747 T104S probably benign Het
BC005537 T C 13: 24,805,986 probably null Het
Chrdl2 T C 7: 100,016,990 V39A possibly damaging Het
Clmp C G 9: 40,782,441 S318W probably damaging Het
Cmas T C 6: 142,772,127 S323P probably damaging Het
Cnksr3 T C 10: 7,129,132 T80A probably benign Het
Ddx25 T C 9: 35,542,002 Y484C probably damaging Het
Dennd6b A G 15: 89,188,872 V154A probably damaging Het
Dmxl1 G A 18: 49,857,249 V252I probably benign Het
Dnah2 T C 11: 69,451,050 Y3003C probably damaging Het
Dnhd1 T C 7: 105,721,273 probably null Het
Dppa4 G A 16: 48,291,233 A194T probably damaging Het
Dst T C 1: 34,189,446 V2218A possibly damaging Het
Dytn G C 1: 63,633,873 S457C probably damaging Het
Fndc3a G A 14: 72,540,328 Q1101* probably null Het
Focad A T 4: 88,357,442 probably null Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gm5093 A G 17: 46,439,696 F135S probably benign Het
Gmeb1 A T 4: 132,242,448 D71E possibly damaging Het
Heatr5b G A 17: 78,817,563 R587C probably damaging Het
Hrasls5 A G 19: 7,639,634 probably benign Het
Jakmip2 T C 18: 43,559,214 probably null Het
Mier3 T A 13: 111,705,244 L111Q probably damaging Het
Mrgprg G A 7: 143,765,042 S111F possibly damaging Het
Mybl1 T C 1: 9,671,676 K677R probably benign Het
Nhsl1 T C 10: 18,531,575 S1486P probably damaging Het
Nup133 A G 8: 123,915,375 I783T probably benign Het
Olfr262 A T 19: 12,241,592 I23K probably benign Het
Olfr961 A T 9: 39,647,163 T146S probably benign Het
Pigr A T 1: 130,841,544 I31L probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel6 T A 2: 87,508,573 M39K possibly damaging Het
Rapgef6 T A 11: 54,639,727 probably null Het
Rinl T C 7: 28,796,904 C437R probably damaging Het
Shank1 T C 7: 44,316,075 S192P unknown Het
Slc2a10 A T 2: 165,517,650 Y478F probably damaging Het
Slit2 T A 5: 48,257,051 C970S possibly damaging Het
Stard9 T C 2: 120,666,376 S119P probably damaging Het
Stim2 C A 5: 54,116,109 D568E probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf3 A G 12: 111,255,323 E306G probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll6 T C 11: 96,158,888 S811P possibly damaging Het
Ubr7 A G 12: 102,769,178 K299E probably benign Het
Urb1 C A 16: 90,796,492 V251L probably damaging Het
Vps13b G T 15: 35,422,444 E183D probably damaging Het
Zfp35 T G 18: 24,003,500 Y300* probably null Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp938 C T 10: 82,227,798 probably null Het
Other mutations in Slc37a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Slc37a3 APN 6 39337262 missense probably damaging 1.00
IGL02447:Slc37a3 APN 6 39337195 missense probably benign 0.00
IGL03017:Slc37a3 APN 6 39349381 missense probably benign 0.13
IGL03142:Slc37a3 APN 6 39359985 splice site probably null
IGL03164:Slc37a3 APN 6 39345303 missense probably benign 0.02
R0240:Slc37a3 UTSW 6 39337238 missense probably benign 0.02
R0551:Slc37a3 UTSW 6 39352754 unclassified probably benign
R1866:Slc37a3 UTSW 6 39359968 missense probably damaging 1.00
R2242:Slc37a3 UTSW 6 39338805 missense probably benign 0.00
R4410:Slc37a3 UTSW 6 39338813 missense probably benign
R4784:Slc37a3 UTSW 6 39337223 missense probably benign 0.12
R4983:Slc37a3 UTSW 6 39352717 nonsense probably null
R5543:Slc37a3 UTSW 6 39355026 missense probably damaging 1.00
R6309:Slc37a3 UTSW 6 39357460 makesense probably null
R7849:Slc37a3 UTSW 6 39364583 missense possibly damaging 0.74
R7872:Slc37a3 UTSW 6 39347310 missense probably damaging 1.00
R7932:Slc37a3 UTSW 6 39364583 missense possibly damaging 0.74
R7955:Slc37a3 UTSW 6 39347310 missense probably damaging 1.00
R8062:Slc37a3 UTSW 6 39364596 missense probably damaging 1.00
Z1177:Slc37a3 UTSW 6 39350076 missense possibly damaging 0.92
Z1177:Slc37a3 UTSW 6 39355011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCATCTATTTCACTGGAAGCCTGT -3'
(R):5'- AGGAGTCAATTATTTGTTGCCTGGTCAT -3'

Sequencing Primer
(F):5'- TCACTGGAAGCCTGTGTCAAC -3'
(R):5'- cacccgactgctcttcc -3'
Posted On2014-03-14