Incidental Mutation 'R1453:Fndc3a'
ID161627
Institutional Source Beutler Lab
Gene Symbol Fndc3a
Ensembl Gene ENSMUSG00000033487
Gene Namefibronectin type III domain containing 3A
Synonyms1700094E19Rik, Fndc3, D14Ertd453e, F730017H24Rik, sys
MMRRC Submission 039508-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R1453 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location72537946-72710003 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 72540328 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1101 (Q1101*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089017]
Predicted Effect probably null
Transcript: ENSMUST00000089017
AA Change: Q1146*
SMART Domains Protein: ENSMUSP00000086411
Gene: ENSMUSG00000033487
AA Change: Q1146*

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
FN3 467 549 1.84e-9 SMART
FN3 564 647 1.06e-5 SMART
FN3 662 744 2.19e-7 SMART
FN3 759 838 5.48e-8 SMART
FN3 864 937 2.28e-5 SMART
FN3 951 1032 3.22e-5 SMART
FN3 1047 1127 5.63e0 SMART
transmembrane domain 1175 1197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162825
AA Change: Q1101*
SMART Domains Protein: ENSMUSP00000124218
Gene: ENSMUSG00000033487
AA Change: Q1101*

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 158 172 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
FN3 222 314 3.05e-6 SMART
FN3 327 408 3.42e-9 SMART
FN3 423 505 1.84e-9 SMART
FN3 520 603 1.06e-5 SMART
FN3 618 700 2.19e-7 SMART
FN3 715 794 5.48e-8 SMART
FN3 820 893 2.28e-5 SMART
FN3 907 988 3.22e-5 SMART
FN3 1003 1083 5.63e0 SMART
transmembrane domain 1131 1153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Males homozygous for an insertional mutation are sterile; females are fertile. In mutant males, spermatids form multinucleated syncytia and fail to mature, while Sertoli cells exhibit abnormal cytoplasmic vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,422 D477G possibly damaging Het
Abca4 A G 3: 122,069,114 I240M probably benign Het
Abcd3 A T 3: 121,765,061 D595E probably damaging Het
Akap9 A G 5: 3,975,614 probably null Het
Arpc1b A G 5: 145,125,745 D223G probably damaging Het
Atp6ap1l T A 13: 90,898,747 T104S probably benign Het
BC005537 T C 13: 24,805,986 probably null Het
Chrdl2 T C 7: 100,016,990 V39A possibly damaging Het
Clmp C G 9: 40,782,441 S318W probably damaging Het
Cmas T C 6: 142,772,127 S323P probably damaging Het
Cnksr3 T C 10: 7,129,132 T80A probably benign Het
Ddx25 T C 9: 35,542,002 Y484C probably damaging Het
Dennd6b A G 15: 89,188,872 V154A probably damaging Het
Dmxl1 G A 18: 49,857,249 V252I probably benign Het
Dnah2 T C 11: 69,451,050 Y3003C probably damaging Het
Dnhd1 T C 7: 105,721,273 probably null Het
Dppa4 G A 16: 48,291,233 A194T probably damaging Het
Dst T C 1: 34,189,446 V2218A possibly damaging Het
Dytn G C 1: 63,633,873 S457C probably damaging Het
Focad A T 4: 88,357,442 probably null Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gm5093 A G 17: 46,439,696 F135S probably benign Het
Gmeb1 A T 4: 132,242,448 D71E possibly damaging Het
Heatr5b G A 17: 78,817,563 R587C probably damaging Het
Hrasls5 A G 19: 7,639,634 probably benign Het
Jakmip2 T C 18: 43,559,214 probably null Het
Mier3 T A 13: 111,705,244 L111Q probably damaging Het
Mrgprg G A 7: 143,765,042 S111F possibly damaging Het
Mybl1 T C 1: 9,671,676 K677R probably benign Het
Nhsl1 T C 10: 18,531,575 S1486P probably damaging Het
Nup133 A G 8: 123,915,375 I783T probably benign Het
Olfr262 A T 19: 12,241,592 I23K probably benign Het
Olfr961 A T 9: 39,647,163 T146S probably benign Het
Pigr A T 1: 130,841,544 I31L probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel6 T A 2: 87,508,573 M39K possibly damaging Het
Rapgef6 T A 11: 54,639,727 probably null Het
Rinl T C 7: 28,796,904 C437R probably damaging Het
Shank1 T C 7: 44,316,075 S192P unknown Het
Slc2a10 A T 2: 165,517,650 Y478F probably damaging Het
Slc37a3 A T 6: 39,366,943 L12H probably damaging Het
Slit2 T A 5: 48,257,051 C970S possibly damaging Het
Stard9 T C 2: 120,666,376 S119P probably damaging Het
Stim2 C A 5: 54,116,109 D568E probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf3 A G 12: 111,255,323 E306G probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll6 T C 11: 96,158,888 S811P possibly damaging Het
Ubr7 A G 12: 102,769,178 K299E probably benign Het
Urb1 C A 16: 90,796,492 V251L probably damaging Het
Vps13b G T 15: 35,422,444 E183D probably damaging Het
Zfp35 T G 18: 24,003,500 Y300* probably null Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp938 C T 10: 82,227,798 probably null Het
Other mutations in Fndc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Fndc3a APN 14 72559357 splice site probably benign
IGL01120:Fndc3a APN 14 72556662 missense probably benign 0.05
IGL01577:Fndc3a APN 14 72589858 missense probably damaging 0.99
IGL01810:Fndc3a APN 14 72566141 missense probably benign 0.01
IGL01965:Fndc3a APN 14 72540402 missense probably benign 0.09
IGL01992:Fndc3a APN 14 72574556 missense probably benign 0.25
IGL02244:Fndc3a APN 14 72556367 splice site probably benign
IGL02639:Fndc3a APN 14 72574357 missense probably benign 0.08
IGL03076:Fndc3a APN 14 72556468 missense possibly damaging 0.82
IGL03096:Fndc3a APN 14 72599119 missense probably damaging 1.00
PIT4677001:Fndc3a UTSW 14 72574595 missense probably benign 0.02
R0112:Fndc3a UTSW 14 72540495 splice site probably benign
R0379:Fndc3a UTSW 14 72556609 missense probably damaging 1.00
R0381:Fndc3a UTSW 14 72556627 missense probably benign 0.05
R0544:Fndc3a UTSW 14 72557622 splice site probably benign
R1079:Fndc3a UTSW 14 72589807 missense possibly damaging 0.81
R1299:Fndc3a UTSW 14 72566198 splice site probably benign
R1424:Fndc3a UTSW 14 72574371 missense probably damaging 1.00
R1478:Fndc3a UTSW 14 72557632 critical splice donor site probably null
R1573:Fndc3a UTSW 14 72568944 missense probably damaging 0.98
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1743:Fndc3a UTSW 14 72652081 missense probably damaging 1.00
R1852:Fndc3a UTSW 14 72556843 missense probably damaging 0.96
R2097:Fndc3a UTSW 14 72574351 critical splice donor site probably null
R2396:Fndc3a UTSW 14 72683683 missense possibly damaging 0.92
R2512:Fndc3a UTSW 14 72556275 missense probably benign 0.00
R3722:Fndc3a UTSW 14 72540208 missense probably benign 0.39
R5470:Fndc3a UTSW 14 72574568 missense possibly damaging 0.83
R5757:Fndc3a UTSW 14 72556585 missense probably benign
R5931:Fndc3a UTSW 14 72568867 missense probably benign
R6188:Fndc3a UTSW 14 72589961 missense probably damaging 0.99
R6297:Fndc3a UTSW 14 72563540 missense probably damaging 0.98
R6638:Fndc3a UTSW 14 72559248 nonsense probably null
R7221:Fndc3a UTSW 14 72556157 missense probably benign
R7571:Fndc3a UTSW 14 72589896 missense probably damaging 0.99
R7677:Fndc3a UTSW 14 72567414 missense probably benign
R7744:Fndc3a UTSW 14 72561716 missense possibly damaging 0.95
R7849:Fndc3a UTSW 14 72564660 missense probably benign 0.01
R8027:Fndc3a UTSW 14 72553543 missense probably benign 0.04
R8152:Fndc3a UTSW 14 72574380 missense probably damaging 1.00
R8225:Fndc3a UTSW 14 72557677 missense probably benign 0.00
R8295:Fndc3a UTSW 14 72552519 missense probably benign 0.03
Z1176:Fndc3a UTSW 14 72567373 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTTTGCCTAACAACAGAAGCACTG -3'
(R):5'- TTCCGCACATACACAAGATGAGATGAG -3'

Sequencing Primer
(F):5'- GTCTCAATGCCAGTGCTAAATGC -3'
(R):5'- TCCAGAATGTACCTGTGCTAATAG -3'
Posted On2014-03-14