Incidental Mutation 'R1453:Trappc9'
ID161630
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 039508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1453 (G1)
Quality Score203
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73025967 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 377 (R377W)
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: R189W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R189W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089770
AA Change: R368W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168191
AA Change: R368W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170633
AA Change: R377W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R377W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228960
AA Change: R368W

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230270
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,422 D477G possibly damaging Het
Abca4 A G 3: 122,069,114 I240M probably benign Het
Abcd3 A T 3: 121,765,061 D595E probably damaging Het
Akap9 A G 5: 3,975,614 probably null Het
Arpc1b A G 5: 145,125,745 D223G probably damaging Het
Atp6ap1l T A 13: 90,898,747 T104S probably benign Het
BC005537 T C 13: 24,805,986 probably null Het
Chrdl2 T C 7: 100,016,990 V39A possibly damaging Het
Clmp C G 9: 40,782,441 S318W probably damaging Het
Cmas T C 6: 142,772,127 S323P probably damaging Het
Cnksr3 T C 10: 7,129,132 T80A probably benign Het
Ddx25 T C 9: 35,542,002 Y484C probably damaging Het
Dennd6b A G 15: 89,188,872 V154A probably damaging Het
Dmxl1 G A 18: 49,857,249 V252I probably benign Het
Dnah2 T C 11: 69,451,050 Y3003C probably damaging Het
Dnhd1 T C 7: 105,721,273 probably null Het
Dppa4 G A 16: 48,291,233 A194T probably damaging Het
Dst T C 1: 34,189,446 V2218A possibly damaging Het
Dytn G C 1: 63,633,873 S457C probably damaging Het
Fndc3a G A 14: 72,540,328 Q1101* probably null Het
Focad A T 4: 88,357,442 probably null Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gm5093 A G 17: 46,439,696 F135S probably benign Het
Gmeb1 A T 4: 132,242,448 D71E possibly damaging Het
Heatr5b G A 17: 78,817,563 R587C probably damaging Het
Hrasls5 A G 19: 7,639,634 probably benign Het
Jakmip2 T C 18: 43,559,214 probably null Het
Mier3 T A 13: 111,705,244 L111Q probably damaging Het
Mrgprg G A 7: 143,765,042 S111F possibly damaging Het
Mybl1 T C 1: 9,671,676 K677R probably benign Het
Nhsl1 T C 10: 18,531,575 S1486P probably damaging Het
Nup133 A G 8: 123,915,375 I783T probably benign Het
Olfr262 A T 19: 12,241,592 I23K probably benign Het
Olfr961 A T 9: 39,647,163 T146S probably benign Het
Pigr A T 1: 130,841,544 I31L probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel6 T A 2: 87,508,573 M39K possibly damaging Het
Rapgef6 T A 11: 54,639,727 probably null Het
Rinl T C 7: 28,796,904 C437R probably damaging Het
Shank1 T C 7: 44,316,075 S192P unknown Het
Slc2a10 A T 2: 165,517,650 Y478F probably damaging Het
Slc37a3 A T 6: 39,366,943 L12H probably damaging Het
Slit2 T A 5: 48,257,051 C970S possibly damaging Het
Stard9 T C 2: 120,666,376 S119P probably damaging Het
Stim2 C A 5: 54,116,109 D568E probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf3 A G 12: 111,255,323 E306G probably damaging Het
Ttll6 T C 11: 96,158,888 S811P possibly damaging Het
Ubr7 A G 12: 102,769,178 K299E probably benign Het
Urb1 C A 16: 90,796,492 V251L probably damaging Het
Vps13b G T 15: 35,422,444 E183D probably damaging Het
Zfp35 T G 18: 24,003,500 Y300* probably null Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp938 C T 10: 82,227,798 probably null Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- AGGGCAAGCATCTCACAAGTGAC -3'
(R):5'- ATAGCTTTCCCCGAGGGTATCAGG -3'

Sequencing Primer
(F):5'- caaatcccagcaaccacac -3'
(R):5'- AGCCTTGGTGGCAGCTTC -3'
Posted On2014-03-14