Incidental Mutation 'R1453:Dennd6b'
ID161631
Institutional Source Beutler Lab
Gene Symbol Dennd6b
Ensembl Gene ENSMUSG00000015377
Gene NameDENN/MADD domain containing 6B
SynonymsFam116b, 1700027J05Rik
MMRRC Submission 039508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1453 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89182213-89196496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89188872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 154 (V154A)
Ref Sequence ENSEMBL: ENSMUSP00000077978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078953] [ENSMUST00000229755]
Predicted Effect probably damaging
Transcript: ENSMUST00000078953
AA Change: V154A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077978
Gene: ENSMUSG00000015377
AA Change: V154A

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Avl9 42 181 1.1e-8 PFAM
Pfam:DENN 148 344 1.2e-8 PFAM
Pfam:SPA 248 358 6.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229416
Predicted Effect probably benign
Transcript: ENSMUST00000229755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230823
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,422 D477G possibly damaging Het
Abca4 A G 3: 122,069,114 I240M probably benign Het
Abcd3 A T 3: 121,765,061 D595E probably damaging Het
Akap9 A G 5: 3,975,614 probably null Het
Arpc1b A G 5: 145,125,745 D223G probably damaging Het
Atp6ap1l T A 13: 90,898,747 T104S probably benign Het
BC005537 T C 13: 24,805,986 probably null Het
Chrdl2 T C 7: 100,016,990 V39A possibly damaging Het
Clmp C G 9: 40,782,441 S318W probably damaging Het
Cmas T C 6: 142,772,127 S323P probably damaging Het
Cnksr3 T C 10: 7,129,132 T80A probably benign Het
Ddx25 T C 9: 35,542,002 Y484C probably damaging Het
Dmxl1 G A 18: 49,857,249 V252I probably benign Het
Dnah2 T C 11: 69,451,050 Y3003C probably damaging Het
Dnhd1 T C 7: 105,721,273 probably null Het
Dppa4 G A 16: 48,291,233 A194T probably damaging Het
Dst T C 1: 34,189,446 V2218A possibly damaging Het
Dytn G C 1: 63,633,873 S457C probably damaging Het
Fndc3a G A 14: 72,540,328 Q1101* probably null Het
Focad A T 4: 88,357,442 probably null Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gm5093 A G 17: 46,439,696 F135S probably benign Het
Gmeb1 A T 4: 132,242,448 D71E possibly damaging Het
Heatr5b G A 17: 78,817,563 R587C probably damaging Het
Hrasls5 A G 19: 7,639,634 probably benign Het
Jakmip2 T C 18: 43,559,214 probably null Het
Mier3 T A 13: 111,705,244 L111Q probably damaging Het
Mrgprg G A 7: 143,765,042 S111F possibly damaging Het
Mybl1 T C 1: 9,671,676 K677R probably benign Het
Nhsl1 T C 10: 18,531,575 S1486P probably damaging Het
Nup133 A G 8: 123,915,375 I783T probably benign Het
Olfr262 A T 19: 12,241,592 I23K probably benign Het
Olfr961 A T 9: 39,647,163 T146S probably benign Het
Pigr A T 1: 130,841,544 I31L probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel6 T A 2: 87,508,573 M39K possibly damaging Het
Rapgef6 T A 11: 54,639,727 probably null Het
Rinl T C 7: 28,796,904 C437R probably damaging Het
Shank1 T C 7: 44,316,075 S192P unknown Het
Slc2a10 A T 2: 165,517,650 Y478F probably damaging Het
Slc37a3 A T 6: 39,366,943 L12H probably damaging Het
Slit2 T A 5: 48,257,051 C970S possibly damaging Het
Stard9 T C 2: 120,666,376 S119P probably damaging Het
Stim2 C A 5: 54,116,109 D568E probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf3 A G 12: 111,255,323 E306G probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll6 T C 11: 96,158,888 S811P possibly damaging Het
Ubr7 A G 12: 102,769,178 K299E probably benign Het
Urb1 C A 16: 90,796,492 V251L probably damaging Het
Vps13b G T 15: 35,422,444 E183D probably damaging Het
Zfp35 T G 18: 24,003,500 Y300* probably null Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp938 C T 10: 82,227,798 probably null Het
Other mutations in Dennd6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02709:Dennd6b APN 15 89190922 splice site probably benign
IGL03109:Dennd6b APN 15 89184985 utr 3 prime probably benign
IGL03133:Dennd6b APN 15 89188523 critical splice acceptor site probably null
P0016:Dennd6b UTSW 15 89186977 missense probably benign
PIT4791001:Dennd6b UTSW 15 89186752 critical splice donor site probably null
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0268:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0344:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0391:Dennd6b UTSW 15 89187214 missense probably damaging 1.00
R1655:Dennd6b UTSW 15 89196340 missense unknown
R1670:Dennd6b UTSW 15 89185337 intron probably benign
R1765:Dennd6b UTSW 15 89190303 nonsense probably null
R1968:Dennd6b UTSW 15 89190341 missense possibly damaging 0.63
R3692:Dennd6b UTSW 15 89186827 splice site probably benign
R4344:Dennd6b UTSW 15 89188663 missense probably benign 0.00
R4736:Dennd6b UTSW 15 89185592 missense probably benign 0.00
R5030:Dennd6b UTSW 15 89196251 missense possibly damaging 0.82
R5058:Dennd6b UTSW 15 89187350 missense possibly damaging 0.69
R5509:Dennd6b UTSW 15 89185022 missense probably damaging 1.00
R6005:Dennd6b UTSW 15 89188168 missense possibly damaging 0.91
R6160:Dennd6b UTSW 15 89188821 missense probably damaging 0.97
R6535:Dennd6b UTSW 15 89186367 missense probably damaging 1.00
R6646:Dennd6b UTSW 15 89186184 missense probably damaging 0.99
R7098:Dennd6b UTSW 15 89188687 missense probably damaging 1.00
R7169:Dennd6b UTSW 15 89188852 missense possibly damaging 0.80
R7381:Dennd6b UTSW 15 89186173 missense possibly damaging 0.84
R7706:Dennd6b UTSW 15 89185244 missense probably benign 0.19
R8070:Dennd6b UTSW 15 89185373 missense probably benign 0.29
X0063:Dennd6b UTSW 15 89185420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAAAAGGCTGAGATGAGACCG -3'
(R):5'- CATCACACTGCCAGGGTAAGGAAC -3'

Sequencing Primer
(F):5'- GCTGAGATGAGACCGTGTTG -3'
(R):5'- TGTCCAGTCCTGACACATGAG -3'
Posted On2014-03-14