Mutagenetix > Incidental Mutation

Incidental Mutation 'R1453:Urb1'

161635

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

MMRRC Submission

039508-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1453 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 90796492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 251 (V251L)

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000140920
AA Change: V251L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: V251L

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142955

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 90.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430105I19Rik	T	C	2: 118,757,422	D477G	possibly damaging	Het
Abca4	A	G	3: 122,069,114	I240M	probably benign	Het
Abcd3	A	T	3: 121,765,061	D595E	probably damaging	Het
Akap9	A	G	5: 3,975,614		probably null	Het
Arpc1b	A	G	5: 145,125,745	D223G	probably damaging	Het
Atp6ap1l	T	A	13: 90,898,747	T104S	probably benign	Het
BC005537	T	C	13: 24,805,986		probably null	Het
Chrdl2	T	C	7: 100,016,990	V39A	possibly damaging	Het
Clmp	C	G	9: 40,782,441	S318W	probably damaging	Het
Cmas	T	C	6: 142,772,127	S323P	probably damaging	Het
Cnksr3	T	C	10: 7,129,132	T80A	probably benign	Het
Ddx25	T	C	9: 35,542,002	Y484C	probably damaging	Het
Dennd6b	A	G	15: 89,188,872	V154A	probably damaging	Het
Dmxl1	G	A	18: 49,857,249	V252I	probably benign	Het
Dnah2	T	C	11: 69,451,050	Y3003C	probably damaging	Het
Dnhd1	T	C	7: 105,721,273		probably null	Het
Dppa4	G	A	16: 48,291,233	A194T	probably damaging	Het
Dst	T	C	1: 34,189,446	V2218A	possibly damaging	Het
Dytn	G	C	1: 63,633,873	S457C	probably damaging	Het
Fndc3a	G	A	14: 72,540,328	Q1101*	probably null	Het
Focad	A	T	4: 88,357,442		probably null	Het
Gas2l2	T	A	11: 83,422,081	T802S	probably benign	Het
Gm5093	A	G	17: 46,439,696	F135S	probably benign	Het
Gmeb1	A	T	4: 132,242,448	D71E	possibly damaging	Het
Heatr5b	G	A	17: 78,817,563	R587C	probably damaging	Het
Hrasls5	A	G	19: 7,639,634		probably benign	Het
Jakmip2	T	C	18: 43,559,214		probably null	Het
Mier3	T	A	13: 111,705,244	L111Q	probably damaging	Het
Mrgprg	G	A	7: 143,765,042	S111F	possibly damaging	Het
Mybl1	T	C	1: 9,671,676	K677R	probably benign	Het
Nhsl1	T	C	10: 18,531,575	S1486P	probably damaging	Het
Nup133	A	G	8: 123,915,375	I783T	probably benign	Het
Olfr262	A	T	19: 12,241,592	I23K	probably benign	Het
Olfr961	A	T	9: 39,647,163	T146S	probably benign	Het
Pigr	A	T	1: 130,841,544	I31L	probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Pramel6	T	A	2: 87,508,573	M39K	possibly damaging	Het
Rapgef6	T	A	11: 54,639,727		probably null	Het
Rinl	T	C	7: 28,796,904	C437R	probably damaging	Het
Shank1	T	C	7: 44,316,075	S192P	unknown	Het
Slc2a10	A	T	2: 165,517,650	Y478F	probably damaging	Het
Slc37a3	A	T	6: 39,366,943	L12H	probably damaging	Het
Slit2	T	A	5: 48,257,051	C970S	possibly damaging	Het
Stard9	T	C	2: 120,666,376	S119P	probably damaging	Het
Stim2	C	A	5: 54,116,109	D568E	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Traf3	A	G	12: 111,255,323	E306G	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll6	T	C	11: 96,158,888	S811P	possibly damaging	Het
Ubr7	A	G	12: 102,769,178	K299E	probably benign	Het
Vps13b	G	T	15: 35,422,444	E183D	probably damaging	Het
Zfp35	T	G	18: 24,003,500	Y300*	probably null	Het
Zfp414	C	T	17: 33,630,038	T33I	probably damaging	Het
Zfp938	C	T	10: 82,227,798		probably null	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1625:Urb1	UTSW	16	90774048	critical splice donor site	probably null
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R2850:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4809:Urb1	UTSW	16	90759842	missense	possibly damaging	0.82
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R4969:Urb1	UTSW	16	90805411	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R6838:Urb1	UTSW	16	90782106	missense	possibly damaging	0.93
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7440:Urb1	UTSW	16	90787408	missense	probably damaging	1.00
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7603:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
R8324:Urb1	UTSW	16	90791190	missense	probably damaging	1.00
R8680:Urb1	UTSW	16	90774625	missense	probably benign	0.00
R8785:Urb1	UTSW	16	90803423	missense	probably benign	0.07
R8914:Urb1	UTSW	16	90810234	missense	probably damaging	1.00
R8959:Urb1	UTSW	16	90774117	missense	probably benign	0.26
R9005:Urb1	UTSW	16	90753790	missense	probably benign	0.01
R9126:Urb1	UTSW	16	90769402	missense	possibly damaging	0.53
R9195:Urb1	UTSW	16	90792750	missense	probably benign	0.03
R9276:Urb1	UTSW	16	90772575	splice site	probably benign
R9534:Urb1	UTSW	16	90786208	missense	possibly damaging	0.54
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATCCTGACTGTGACTCTGCGACTC -3'
(R):5'- ATGTAAGAACTCTCGCCTGCTCCC -3'

Sequencing Primer
(F):5'- CACCGCAGCACTTTCTGG -3'
(R):5'- TTATGGTCCAGTCAGAGCAC -3'

Posted On

2014-03-14