Incidental Mutation 'R1453:Heatr5b'
ID161639
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission 039508-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R1453 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78817563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 587 (R587C)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably damaging
Transcript: ENSMUST00000097281
AA Change: R587C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: R587C

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,422 D477G possibly damaging Het
Abca4 A G 3: 122,069,114 I240M probably benign Het
Abcd3 A T 3: 121,765,061 D595E probably damaging Het
Akap9 A G 5: 3,975,614 probably null Het
Arpc1b A G 5: 145,125,745 D223G probably damaging Het
Atp6ap1l T A 13: 90,898,747 T104S probably benign Het
BC005537 T C 13: 24,805,986 probably null Het
Chrdl2 T C 7: 100,016,990 V39A possibly damaging Het
Clmp C G 9: 40,782,441 S318W probably damaging Het
Cmas T C 6: 142,772,127 S323P probably damaging Het
Cnksr3 T C 10: 7,129,132 T80A probably benign Het
Ddx25 T C 9: 35,542,002 Y484C probably damaging Het
Dennd6b A G 15: 89,188,872 V154A probably damaging Het
Dmxl1 G A 18: 49,857,249 V252I probably benign Het
Dnah2 T C 11: 69,451,050 Y3003C probably damaging Het
Dnhd1 T C 7: 105,721,273 probably null Het
Dppa4 G A 16: 48,291,233 A194T probably damaging Het
Dst T C 1: 34,189,446 V2218A possibly damaging Het
Dytn G C 1: 63,633,873 S457C probably damaging Het
Fndc3a G A 14: 72,540,328 Q1101* probably null Het
Focad A T 4: 88,357,442 probably null Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gm5093 A G 17: 46,439,696 F135S probably benign Het
Gmeb1 A T 4: 132,242,448 D71E possibly damaging Het
Hrasls5 A G 19: 7,639,634 probably benign Het
Jakmip2 T C 18: 43,559,214 probably null Het
Mier3 T A 13: 111,705,244 L111Q probably damaging Het
Mrgprg G A 7: 143,765,042 S111F possibly damaging Het
Mybl1 T C 1: 9,671,676 K677R probably benign Het
Nhsl1 T C 10: 18,531,575 S1486P probably damaging Het
Nup133 A G 8: 123,915,375 I783T probably benign Het
Olfr262 A T 19: 12,241,592 I23K probably benign Het
Olfr961 A T 9: 39,647,163 T146S probably benign Het
Pigr A T 1: 130,841,544 I31L probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel6 T A 2: 87,508,573 M39K possibly damaging Het
Rapgef6 T A 11: 54,639,727 probably null Het
Rinl T C 7: 28,796,904 C437R probably damaging Het
Shank1 T C 7: 44,316,075 S192P unknown Het
Slc2a10 A T 2: 165,517,650 Y478F probably damaging Het
Slc37a3 A T 6: 39,366,943 L12H probably damaging Het
Slit2 T A 5: 48,257,051 C970S possibly damaging Het
Stard9 T C 2: 120,666,376 S119P probably damaging Het
Stim2 C A 5: 54,116,109 D568E probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf3 A G 12: 111,255,323 E306G probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll6 T C 11: 96,158,888 S811P possibly damaging Het
Ubr7 A G 12: 102,769,178 K299E probably benign Het
Urb1 C A 16: 90,796,492 V251L probably damaging Het
Vps13b G T 15: 35,422,444 E183D probably damaging Het
Zfp35 T G 18: 24,003,500 Y300* probably null Het
Zfp414 C T 17: 33,630,038 T33I probably damaging Het
Zfp938 C T 10: 82,227,798 probably null Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCAAAGGGTCATCTCTGTCAAGCTG -3'
(R):5'- GGCGTGTTAGAGACCTTGTCCTTC -3'

Sequencing Primer
(F):5'- TTCGCTAGATGAGAACTGTGACC -3'
(R):5'- tggactctgggccatctac -3'
Posted On2014-03-14