Incidental Mutation 'R1451:Zgpat'
ID161648
Institutional Source Beutler Lab
Gene Symbol Zgpat
Ensembl Gene ENSMUSG00000027582
Gene Namezinc finger, CCCH-type with G patch domain
Synonyms
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1451 (G1)
Quality Score215
Status Validated
Chromosome2
Chromosomal Location181364928-181383628 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 181380191 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029105] [ENSMUST00000048077] [ENSMUST00000108804] [ENSMUST00000108807] [ENSMUST00000116366]
Predicted Effect probably benign
Transcript: ENSMUST00000029105
SMART Domains Protein: ENSMUSP00000029105
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048077
SMART Domains Protein: ENSMUSP00000045010
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 27 266 5.6e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108804
SMART Domains Protein: ENSMUSP00000104432
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 27 87 9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108807
SMART Domains Protein: ENSMUSP00000104435
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116366
SMART Domains Protein: ENSMUSP00000112067
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126611
SMART Domains Protein: ENSMUSP00000119181
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 4 246 9.6e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131284
Predicted Effect probably benign
Transcript: ENSMUST00000140943
SMART Domains Protein: ENSMUSP00000117558
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 24 189 5.4e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151457
Predicted Effect probably benign
Transcript: ENSMUST00000156258
SMART Domains Protein: ENSMUSP00000122714
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
G_patch 1 44 1.18e-5 SMART
low complexity region 66 79 N/A INTRINSIC
coiled coil region 117 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184328
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Other mutations in Zgpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Zgpat APN 2 181378889 missense probably benign 0.02
IGL02221:Zgpat APN 2 181378858 missense probably benign 0.41
IGL02507:Zgpat APN 2 181366236 missense probably damaging 1.00
IGL03124:Zgpat APN 2 181366180 missense probably benign 0.05
R0559:Zgpat UTSW 2 181380192 splice site probably benign
R1541:Zgpat UTSW 2 181378865 missense probably benign 0.01
R1758:Zgpat UTSW 2 181378840 missense probably damaging 1.00
R2445:Zgpat UTSW 2 181366160 nonsense probably null
R3038:Zgpat UTSW 2 181366018 unclassified probably benign
R3700:Zgpat UTSW 2 181365646 unclassified probably benign
R4888:Zgpat UTSW 2 181378858 missense probably benign 0.41
R5594:Zgpat UTSW 2 181365627 unclassified probably benign
R6890:Zgpat UTSW 2 181378511 missense probably damaging 0.98
R7023:Zgpat UTSW 2 181366018 unclassified probably benign
R7350:Zgpat UTSW 2 181380435 missense
R7396:Zgpat UTSW 2 181366089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGAGGGAAATCACTGGACC -3'
(R):5'- TTCTGCCAAGGCAGTTTGGAGC -3'

Sequencing Primer
(F):5'- CCCCCGGAATGTGTTTGAC -3'
(R):5'- GGCCGCTAGAACTCTGTCATC -3'
Posted On2014-03-14