Mutagenetix > Incidental Mutation

Incidental Mutation 'R1451:Megf10'

161697

Institutional Source

Beutler Lab

Gene Symbol

Megf10

Ensembl Gene

ENSMUSG00000024593

Gene Name

multiple EGF-like-domains 10

Synonyms

3000002B06Rik, LOC240312

MMRRC Submission

039506-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R1451 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

57133090-57297467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57252859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 315 (S315C)

Ref Sequence

ENSEMBL: ENSMUSP00000075174 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]

AlphaFold

Q6DIB5

Predicted Effect

probably damaging
Transcript: ENSMUST00000075770
AA Change: S315C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: S315C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC
low complexity region	1131	1146	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000139892
AA Change: S315C

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: S315C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.4%
20x: 86.3%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024G13Rik	T	C	14: 32,376,631	E83G	possibly damaging	Het
9530053A07Rik	T	C	7: 28,137,157	F167S	probably damaging	Het
Abca9	A	G	11: 110,127,447	S1116P	probably damaging	Het
Abcc12	T	A	8: 86,557,693	T296S	probably damaging	Het
Adarb2	A	G	13: 8,339,621		probably benign	Het
Arhgef12	C	T	9: 42,992,578		probably benign	Het
Asah1	A	G	8: 41,354,012		probably null	Het
C1ra	A	T	6: 124,521,641	Q431L	probably benign	Het
C1s2	A	T	6: 124,625,494	I580N	probably benign	Het
Cacna2d4	C	T	6: 119,236,824	T68I	probably benign	Het
Car8	A	T	4: 8,189,327	H162Q	probably benign	Het
Ccdc106	A	G	7: 5,059,528	R116G	probably damaging	Het
Ccdc136	T	A	6: 29,419,377	N965K	probably benign	Het
Cd200r3	A	G	16: 44,951,547	E58G	possibly damaging	Het
Cnksr3	T	A	10: 7,126,830	S121C	probably null	Het
Cog6	T	C	3: 53,009,113	M212V	possibly damaging	Het
Ebna1bp2	C	A	4: 118,621,072		probably null	Het
Epha1	C	A	6: 42,361,451	M730I	probably damaging	Het
Fscn2	A	T	11: 120,362,022	E105V	probably damaging	Het
Gars	T	C	6: 55,053,123		probably benign	Het
Itgb4	G	T	11: 115,990,884	G753V	probably damaging	Het
Kif23	C	T	9: 61,924,802	V634M	probably damaging	Het
Krt8	T	C	15: 101,998,829	Y273C	possibly damaging	Het
Lgmn	A	G	12: 102,405,892		probably benign	Het
Lrig3	T	C	10: 126,010,057	I785T	possibly damaging	Het
Lrriq1	A	G	10: 103,202,515		probably benign	Het
Lta4h	A	G	10: 93,480,728	D491G	probably damaging	Het
Mphosph8	C	T	14: 56,668,421	R24C	possibly damaging	Het
Neurog2	A	G	3: 127,633,841	D38G	possibly damaging	Het
Olfr1364	A	T	13: 21,574,287	Y56*	probably null	Het
Olfr1414	T	A	1: 92,511,795	I78F	possibly damaging	Het
Olfr150	T	A	9: 39,737,316	V167D	probably benign	Het
Olfr30	C	T	11: 58,455,532	R139H	probably benign	Het
Olfr339	G	T	2: 36,421,865	A156S	probably benign	Het
Olfr914	A	T	9: 38,606,938	I158F	probably benign	Het
Pcdhb17	A	T	18: 37,486,936	D593V	probably damaging	Het
Pde2a	G	T	7: 101,421,991	E23*	probably null	Het
Prex2	G	A	1: 11,156,259	V749I	probably benign	Het
Ptchd4	A	G	17: 42,502,918	Y570C	probably damaging	Het
Robo3	C	T	9: 37,417,711	R1237K	probably benign	Het
Slc6a1	C	A	6: 114,307,795	Y87*	probably null	Het
Snx13	G	A	12: 35,078,984	A34T	probably benign	Het
Sppl3	T	C	5: 115,088,365	L193P	probably damaging	Het
Tia1	A	T	6: 86,430,339	Y277F	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trappc2l	T	C	8: 122,615,395	F127L	probably damaging	Het
Ushbp1	G	T	8: 71,386,019	Q588K	possibly damaging	Het
Usp43	T	A	11: 67,856,181	H895L	probably benign	Het
Vmn1r179	T	A	7: 23,928,850	C155*	probably null	Het
Vmn2r8	T	A	5: 108,798,067	D558V	probably damaging	Het
Vps13a	T	C	19: 16,710,864	T860A	probably benign	Het
Vps50	A	G	6: 3,565,628	N522S	possibly damaging	Het
Zfp180	T	C	7: 24,105,218	F354S	probably benign	Het
Zgpat	A	G	2: 181,380,191		probably benign	Het

Other mutations in Megf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Megf10	APN	18	57240628	missense	probably damaging	1.00
IGL00736:Megf10	APN	18	57292710	missense	probably benign	0.35
IGL01631:Megf10	APN	18	57259797	missense	possibly damaging	0.61
IGL02488:Megf10	APN	18	57292632	missense	probably damaging	1.00
IGL02747:Megf10	APN	18	57290493	missense	probably benign	0.43
IGL03298:Megf10	APN	18	57283838	nonsense	probably null
deep	UTSW	18	57262131	missense	probably damaging	1.00
megalodon	UTSW	18	57287976	nonsense	probably null
sharkie	UTSW	18	57191185	nonsense	probably null
IGL03046:Megf10	UTSW	18	57287983	missense	possibly damaging	0.95
PIT4696001:Megf10	UTSW	18	57277688	missense	probably damaging	1.00
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0115:Megf10	UTSW	18	57259802	missense	possibly damaging	0.67
R0455:Megf10	UTSW	18	57252982	missense	probably benign	0.34
R0602:Megf10	UTSW	18	57262100	missense	probably damaging	0.98
R0630:Megf10	UTSW	18	57287995	missense	probably benign	0.14
R0652:Megf10	UTSW	18	57277724	missense	probably benign	0.00
R0658:Megf10	UTSW	18	57252896	missense	probably benign	0.00
R0761:Megf10	UTSW	18	57287976	nonsense	probably null
R1013:Megf10	UTSW	18	57261219	missense	probably benign	0.00
R1130:Megf10	UTSW	18	57262006	missense	probably benign	0.06
R1699:Megf10	UTSW	18	57277730	splice site	probably null
R1729:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1784:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1870:Megf10	UTSW	18	57191185	nonsense	probably null
R1961:Megf10	UTSW	18	57212354	missense	probably damaging	0.97
R2094:Megf10	UTSW	18	57281713	nonsense	probably null
R2213:Megf10	UTSW	18	57288009	nonsense	probably null
R2853:Megf10	UTSW	18	57293931	missense	probably damaging	1.00
R3772:Megf10	UTSW	18	57283862	missense	probably benign	0.39
R3774:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3775:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3776:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3858:Megf10	UTSW	18	57275835	splice site	probably benign
R3911:Megf10	UTSW	18	57289393	missense	probably damaging	0.99
R3966:Megf10	UTSW	18	57180574	missense	probably damaging	1.00
R4043:Megf10	UTSW	18	57259798	missense	probably damaging	0.98
R4131:Megf10	UTSW	18	57180535	missense	probably damaging	1.00
R4598:Megf10	UTSW	18	57189603	critical splice donor site	probably null
R4598:Megf10	UTSW	18	57287812	missense	probably damaging	1.00
R4726:Megf10	UTSW	18	57287792	missense	probably benign	0.32
R4765:Megf10	UTSW	18	57287794	missense	possibly damaging	0.56
R4874:Megf10	UTSW	18	57293858	missense	probably benign	0.00
R4928:Megf10	UTSW	18	57240673	missense	probably benign
R5412:Megf10	UTSW	18	57191147	missense	probably damaging	0.99
R5901:Megf10	UTSW	18	57277108	missense	probably benign	0.11
R6015:Megf10	UTSW	18	57253028	missense	probably benign	0.01
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6041:Megf10	UTSW	18	57180549	missense	probably benign
R6369:Megf10	UTSW	18	57261187	missense	probably benign	0.06
R6479:Megf10	UTSW	18	57246570	missense	possibly damaging	0.76
R6489:Megf10	UTSW	18	57291807	missense	probably benign	0.01
R7228:Megf10	UTSW	18	57189589	missense	probably damaging	1.00
R7296:Megf10	UTSW	18	57275753	missense	probably damaging	1.00
R7437:Megf10	UTSW	18	57262131	missense	probably damaging	1.00
R7461:Megf10	UTSW	18	57252853	missense	probably damaging	0.98
R7488:Megf10	UTSW	18	57191115	missense	probably damaging	0.99
R7492:Megf10	UTSW	18	57291794	missense	probably benign	0.00
R7542:Megf10	UTSW	18	57189570	missense	probably benign	0.07
R7636:Megf10	UTSW	18	57276989	missense	possibly damaging	0.85
R7646:Megf10	UTSW	18	57293999	unclassified	probably benign
R7650:Megf10	UTSW	18	57293999	unclassified	probably benign
R7713:Megf10	UTSW	18	57293999	unclassified	probably benign
R7714:Megf10	UTSW	18	57293999	unclassified	probably benign
R7716:Megf10	UTSW	18	57293999	unclassified	probably benign
R7796:Megf10	UTSW	18	57277659	missense	possibly damaging	0.85
R7915:Megf10	UTSW	18	57240735	missense	probably benign	0.05
R8221:Megf10	UTSW	18	57283821	missense	probably benign	0.00
R8527:Megf10	UTSW	18	57292718	missense	probably benign	0.00
R8559:Megf10	UTSW	18	57240627	missense	probably damaging	1.00
R9117:Megf10	UTSW	18	57259701	missense	probably damaging	1.00
R9337:Megf10	UTSW	18	57261180	nonsense	probably null
R9481:Megf10	UTSW	18	57262018	missense	probably benign	0.38
R9644:Megf10	UTSW	18	57242701	missense	probably benign
RF003:Megf10	UTSW	18	57294027	unclassified	probably benign
Z1176:Megf10	UTSW	18	57277694	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCTGGCCCCGTTAACTATTCATGC -3'
(R):5'- TCACATTTGATGCCGTAAAGCCCC -3'

Sequencing Primer
(F):5'- TGGAAGGTTCAGAATTCCTCG -3'
(R):5'- GTAAAGCCCCTCGGGACAC -3'

Posted On

2014-03-14