Mutagenetix > Incidental Mutation

Incidental Mutation 'R1455:Trip12'

161699

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

039510-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1455 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84759100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 800 (I800V)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000189841]

AlphaFold

G5E870

Predicted Effect

probably benign
Transcript: ENSMUST00000027421
AA Change: I800V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: I800V

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185567

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186465
AA Change: I800V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: I800V

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186648

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186894
AA Change: I800V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: I800V

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189841

SMART Domains

Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	1	24	N/A	INTRINSIC
low complexity region	51	63	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.8%
20x: 87.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,904	N285D	possibly damaging	Het
9230110C19Rik	T	G	9: 8,022,456	N255T	probably benign	Het
Adam9	T	G	8: 24,993,109	M227L	probably benign	Het
Ankrd35	A	G	3: 96,678,155	D21G	probably damaging	Het
Arhgap32	C	T	9: 32,260,085	A1387V	probably benign	Het
Atg4d	T	A	9: 21,270,801	V306E	probably damaging	Het
Brsk1	G	A	7: 4,704,251	V268M	probably damaging	Het
Clec4a4	A	G	6: 123,012,799	E133G	possibly damaging	Het
Col24a1	T	A	3: 145,460,838	L1076H	probably damaging	Het
Ddah1	G	T	3: 145,889,109	R208L	probably benign	Het
Dysf	A	G	6: 84,113,386	N960S	probably benign	Het
Egln2	A	G	7: 27,160,371	Y306H	probably damaging	Het
Fgfr1	T	C	8: 25,562,276	V293A	possibly damaging	Het
Gja3	A	G	14: 57,036,385	Y177H	probably damaging	Het
Glul	T	A	1: 153,907,099		probably null	Het
Gprc5a	G	A	6: 135,079,247	V231I	probably benign	Het
Kdm4d	C	A	9: 14,464,395	A56S	probably damaging	Het
Lingo4	G	A	3: 94,399,392		probably benign	Het
Map6	A	G	7: 99,268,214	T65A	probably damaging	Het
Mmrn2	T	C	14: 34,399,132	I653T	probably benign	Het
Ndufa12	A	G	10: 94,203,314	T70A	probably benign	Het
Nfe2l3	C	A	6: 51,457,764	P435T	possibly damaging	Het
Npc1l1	A	T	11: 6,228,174	V412E	possibly damaging	Het
Olfr303	A	T	7: 86,394,595	F301Y	probably damaging	Het
Olfr33	A	T	7: 102,713,998	Y138*	probably null	Het
Pcnx	T	C	12: 81,973,234	F1344L	probably damaging	Het
Pi4ka	A	G	16: 17,363,954	V297A	probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Pramel7	T	C	2: 87,489,723	T409A	probably benign	Het
Proc	C	G	18: 32,123,398	M405I	probably damaging	Het
Serinc2	C	A	4: 130,264,340	A105S	probably damaging	Het
Slc4a10	G	T	2: 62,286,930	K744N	probably damaging	Het
Spdye4c	A	T	2: 128,596,558	I279F	probably damaging	Het
Srcap	G	T	7: 127,530,650	R568L	probably damaging	Het
Stag3	T	A	5: 138,311,735	M1215K	probably benign	Het
Tenm3	C	T	8: 48,279,048	A1274T	possibly damaging	Het
Tet2	A	G	3: 133,473,645	V1253A	possibly damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Zfc3h1	T	C	10: 115,412,108	I1072T	probably benign	Het
Zfp148	T	A	16: 33,495,465		probably null	Het
Zfp941	A	G	7: 140,812,774	V224A	probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAAGAAGGTACATGGTAGTGCAA -3'
(R):5'- CTACGTTCTGTCAGTTTACCAGCCTC -3'

Sequencing Primer
(F):5'- gagaaatagctcttcaagttaccc -3'
(R):5'- GTCAGTTTACCAGCCTCATAAAATAC -3'

Posted On

2014-03-14